Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-221-5p URS0000593537_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (ENA, miRBase, TarBase, GeneCards, RefSeq, MalaCards, PSICQUIC, LncBase, IntAct). Described in 60 papers. Homo sapiens (human) hsa-miR-221-5p sequence is a product of hsa-miR-221, miR-221, miR-221-5p, MIR221, hsa-miR-221-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 13CDNA73, 14-3-3-zeta, 16A, 182-FIP, 1A1-3B, 30K, 6A3-5, 80K-L, 82-FIP.

Interactions 3

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-221-5p interacts with:

Interaction id Participant Synonyms
EBI-20560373 intact:EBI-20560164 EBI-20560164 ENST00000644787.1 mrna_socs1
URS0000593537_9606-0 Q9UBB5 Q9UBB5
URS0000593537_9606-1 Q9UBB5 Q9UBB5

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCUGGCAUACAAUGUAGAUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 4 other species

    1. Alligator mississippiensis ami-miR-221-5p
    2. Columba livia cli-miR-221-5p
    3. Mus musculus Mus_musculus piRNA piR-mmu-38802736
    4. Paralichthys olivaceus (Japanese flounder) pol-miR-221-5p
    5. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3242034