Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-573 URS000058BB84_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-573: Hsa-mir-573 is a microRNA that has been studied in breast cancer cells [PMC4381608]. In a comparison between SUM149PT and MCF-7 transfected breast cancer cells, it was found that the mRNA levels of pro-angiogenic factors VEGFA and ANGPT2 were reduced only in BRCA1 deficient cells transfected with hsa-mir-573 mimic [PMC4381608]. Additionally, it was discovered that elevated expression levels of hsa-mir-573 were significantly associated with improved disease-specific survival (DSS) in BRCA patients [PMC9428000]. This finding suggests that hsa-mir-573 may play a role in the prognosis of BRCA patients. References: [PMC4381608] - Liu, Y., Liu, R., Yang, F., Cheng, R., Chen, X., Cui, S. et al. (2015). miR-19a promotes colorectal cancer proliferation and migration by targeting TIA1. Molecular Cancer 14(1), 14. [PMC9428000] - Chen YH et al. (2021). Identification of microRNA signature associated with prognosis and survival in patients with breast cancer by bioinformatics analysis. World Journal of Surgical Oncology 19(1), 201.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGAAGUGAUGUGUAACUGAUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications