Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3660 URS000058863C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3660: Hsa-mir-3660 is a microRNA that was analyzed in a study on primary open-angle glaucoma (PEXG) [PMC7655255]. Although the C-index value of hsa-mir-3660 was higher than the RNA prognostic biomarker model, the Kaplan-Meier analysis showed that hsa-mir-3660 cannot significantly distinguish between high- and low-risk groups [PMC7655255]. In the study, ten miRNAs were found to be downregulated in PEXG, including hsa-mir-3660 [PMC10000531]. Additionally, six out of twenty selected miRNAs, including hsa-mir-3660, were found to influence the expression of genes involved in protein modification and metabolism [PMC10000531]. The expression level of hsa-mir-3660 was reduced by 13.15% in PEXG compared to the control group [PMC10000531]. Functional analysis revealed that hsa-mir-3660 is involved in ECM receptor interactions through its regulation of LAMA3 gene expression [PMC10000531]. In another study on lung cancer patients living in areas with high levels of radon, a decrease in the expression level of hsa-mir-3660 was observed among other microRNAs [PMC8962319]. Furthermore, five microRNAs including hsa-mir-3660 had low expression levels and were even absent (expression level zero) in more than 20% of tumor tissue samples from lung cancer patients [PMC5912208]. Overall, these studies highlight the potential role of hsa-mir-3660 as a biomarker and its involvement in various biological processes. However, further research is needed to fully understand its functional significance and clinical implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGACAGGAGAGCAUUUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications