v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila willistoni tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1, tRNA-Thr-CGT-3-2) secondary structure diagram

Drosophila willistoni tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1, tRNA-Thr-CGT-3-2) URS0000580B70_7260

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCUCUUUAGCUCAGUGGUAGAGCGUUGGUCUCGUAAACCAAAGGCCGUGAGUUCAACCCUCACAGGAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Drosophila ananassae tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1, tRNA-Thr-CGT-2-2)
  2. Drosophila busckii tRNA
  3. Drosophila erecta tRNA-Thr (CGT) (tRNA-Thr-CGT-1 1 to 3)
  4. Drosophila ficusphila tRNA
  5. Drosophila grimshawi tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1, tRNA-Thr-CGT-2-2)
  6. Drosophila guanche tRNA.Thr
  7. Drosophila gunungcola tRNA-OTHER
  8. Drosophila melanogaster transfer RNA:Threonine-CGT 1-3 (Dmel_CR31333, Dmel_CR31334, Dmel_CR31480)
  9. Drosophila mojavensis tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1, tRNA-Thr-CGT-2-2)
  10. Drosophila persimilis tRNA-Thr (CGT) (tRNA-Thr-CGT-1 1 to 3)
  11. Drosophila pseudoobscura pseudoobscura tRNA-Thr (CGT) (tRNA-Thr-CGT-2 1 to 3)
  12. Drosophila sechellia tRNA-Thr (CGT) (tRNA-Thr-CGT-1 1 to 4)
  13. Drosophila simulans tRNA-Thr (CGT) (tRNA-Thr-CGT-1 1 to 3)
  14. Drosophila virilis tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1, tRNA-Thr-CGT-2-2)
  15. Drosophila yakuba tRNA-Thr (CGT) (tRNA-Thr-CGT-1 1 to 5)
 2D structure Publications