Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS000057FD8B_559292

Automated summary: This snoRNA sequence is 171 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (RefSeq, IntAct, SGD, ENA). Described in 27 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR85, RF01240). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR85 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 1

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

IntAct ID Participant Synonyms
EBI-10921353 P32495 D1045 D6VRE6 EBI-12014 H/ACA snoRNP protein NHP2 High mobility group-like nuclear protein 2 NHP2 P32495 YDL208W nhp2_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACUAGCACAUAUGUCAAAUUCCUAAUUAACGUUUUUUAUAUUCAUCGUUUCUUAGAGCCGUAAUUGUGCUGAUAUCAAUAUCAGGGAAGAACAUACCAUAUAGAGGUGUCAAGUACACCGAACGAUCGUGGUGCUCCCUCAGCCACGGGCGUGCUUGGACGCUAUUCCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 86 other species

    1. Saccharomyces cerevisiae small nucleolar RNA snR85
    2. Saccharomyces cerevisiae Kyokai no. 7 K7_snR85
    3. Saccharomyces cerevisiae P283 SNR85
    4. Saccharomyces cerevisiae P301 SNR85
    5. Saccharomyces cerevisiae PE-2 SNR85
    6. Saccharomyces cerevisiae R008 SNR85
    7. Saccharomyces cerevisiae R103 SNR85
    8. Saccharomyces cerevisiae YJM1078 SNR85
    9. Saccharomyces cerevisiae YJM1083 SNR85
    10. Saccharomyces cerevisiae YJM1129 SNR85
    11. Saccharomyces cerevisiae YJM1133 SNR85
    12. Saccharomyces cerevisiae YJM1190 SNR85
    13. Saccharomyces cerevisiae YJM1199 SNR85
    14. Saccharomyces cerevisiae YJM1202 SNR85
    15. Saccharomyces cerevisiae YJM1208 SNR85
    16. Saccharomyces cerevisiae YJM1242 SNR85
    17. Saccharomyces cerevisiae YJM1244 SNR85
    18. Saccharomyces cerevisiae YJM1248 SNR85
    19. Saccharomyces cerevisiae YJM1250 SNR85
    20. Saccharomyces cerevisiae YJM1252 SNR85
    21. Saccharomyces cerevisiae YJM1273 SNR85
    22. Saccharomyces cerevisiae YJM1304 SNR85
    23. Saccharomyces cerevisiae YJM1307 SNR85
    24. Saccharomyces cerevisiae YJM1311 SNR85
    25. Saccharomyces cerevisiae YJM1326 SNR85
    26. Saccharomyces cerevisiae YJM1332 SNR85
    27. Saccharomyces cerevisiae YJM1336 SNR85
    28. Saccharomyces cerevisiae YJM1338 SNR85
    29. Saccharomyces cerevisiae YJM1342 SNR85
    30. Saccharomyces cerevisiae YJM1355 SNR85
    31. Saccharomyces cerevisiae YJM1356 SNR85
    32. Saccharomyces cerevisiae YJM1383 SNR85
    33. Saccharomyces cerevisiae YJM1385 SNR85
    34. Saccharomyces cerevisiae YJM1387 SNR85
    35. Saccharomyces cerevisiae YJM1388 SNR85
    36. Saccharomyces cerevisiae YJM1389 SNR85
    37. Saccharomyces cerevisiae YJM1400 SNR85
    38. Saccharomyces cerevisiae YJM1402 SNR85
    39. Saccharomyces cerevisiae YJM1415 SNR85
    40. Saccharomyces cerevisiae YJM1417 SNR85
    41. Saccharomyces cerevisiae YJM1419 SNR85
    42. Saccharomyces cerevisiae YJM1433 SNR85
    43. Saccharomyces cerevisiae YJM1434 SNR85
    44. Saccharomyces cerevisiae YJM1439 SNR85
    45. Saccharomyces cerevisiae YJM1444 SNR85
    46. Saccharomyces cerevisiae YJM1447 SNR85
    47. Saccharomyces cerevisiae YJM1450 SNR85
    48. Saccharomyces cerevisiae YJM1460 SNR85
    49. Saccharomyces cerevisiae YJM1477 SNR85
    50. Saccharomyces cerevisiae YJM1478 SNR85
    51. Saccharomyces cerevisiae YJM1479 SNR85
    52. Saccharomyces cerevisiae YJM1526 SNR85
    53. Saccharomyces cerevisiae YJM1527 SNR85
    54. Saccharomyces cerevisiae YJM1549 SNR85
    55. Saccharomyces cerevisiae YJM1573 SNR85
    56. Saccharomyces cerevisiae YJM1574 SNR85
    57. Saccharomyces cerevisiae YJM1592 SNR85
    58. Saccharomyces cerevisiae YJM1615 SNR85
    59. Saccharomyces cerevisiae YJM189 SNR85
    60. Saccharomyces cerevisiae YJM193 SNR85
    61. Saccharomyces cerevisiae YJM195 SNR85
    62. Saccharomyces cerevisiae YJM244 SNR85
    63. Saccharomyces cerevisiae YJM248 SNR85
    64. Saccharomyces cerevisiae YJM270 SNR85
    65. Saccharomyces cerevisiae YJM271 SNR85
    66. Saccharomyces cerevisiae YJM326 SNR85
    67. Saccharomyces cerevisiae YJM428 SNR85
    68. Saccharomyces cerevisiae YJM451 SNR85
    69. Saccharomyces cerevisiae YJM453 SNR85
    70. Saccharomyces cerevisiae YJM456 SNR85
    71. Saccharomyces cerevisiae YJM470 SNR85
    72. Saccharomyces cerevisiae YJM627 SNR85
    73. Saccharomyces cerevisiae YJM681 SNR85
    74. Saccharomyces cerevisiae YJM682 SNR85
    75. Saccharomyces cerevisiae YJM683 SNR85
    76. Saccharomyces cerevisiae YJM689 SNR85
    77. Saccharomyces cerevisiae YJM693 SNR85
    78. Saccharomyces cerevisiae YJM969 SNR85
    79. Saccharomyces cerevisiae YJM972 SNR85
    80. Saccharomyces cerevisiae YJM975 SNR85
    81. Saccharomyces cerevisiae YJM978 SNR85
    82. Saccharomyces cerevisiae YJM981 SNR85
    83. Saccharomyces cerevisiae YJM984 SNR85
    84. Saccharomyces cerevisiae YJM987 SNR85
    85. Saccharomyces cerevisiae YJM990 SNR85
    86. Saccharomyces cerevisiae YJM993 SNR85
    87. Saccharomyces cerevisiae YJM996 SNR85
    2D structure New