Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1247-5p URS000057DF36_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1247: Hsa-mir-1247 is a microRNA that was investigated in a study on ectopic pregnancy [PMC5952075]. The study aimed to identify risk factors that could be used to predict the occurrence of ectopic pregnancy [PMC5952075]. The researchers conducted univariate Cox regression analysis to evaluate the roles of hsa-mir-1247 and hsa-mir-1269a in ectopic pregnancy [PMC5952075]. The specific primer sequences used for hsa-mir-1247 were 5′-ACACTCCAGCTGGGACCCGTCCCGTTCGTCC-3′ (forward) and 5′-CTCAACTGGTGTCGTGGA-3′ (reverse) [PMC5952075]. For hsa-mir-1269a, the primer sequences were 5′-CUGGACUGAGCCGUGCUACUGG-3′ (forward) and 5′-CTCAACTGGTGTCGTGGA-3′ (reverse) [PMC5952075].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCCGUCCCGUUCGUCCCCGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Cavia porcellus cpo-miR-1247-5p
  2. Macaca mulatta mml-miR-1247-5p
  3. Mus musculus (house mouse) mmu-miR-1247-5p
  4. Pan troglodytes ptr-miR-1247
  5. Pongo pygmaeus (Bornean orangutan) ppy-miR-1247
  6. Rattus norvegicus (Norway rat) rno-miR-1247-5p
  7. Tupaia chinensis tch-miR-1247-5p
Publications