Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae P301 tRNA-Ser secondary structure diagram

Saccharomyces cerevisiae P301 tRNA-Ser URS0000576924_1182968

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCACUAUGGCCGAGUGGUUAAGGCGAGAGACUCGAAUGGAAUAAAAAGUUCGGCUAUCUCUUGGGCUCUGCCCGCGCUGGUUCAAAUCCUGCUGGUGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Saccharomyces cerevisiae AWRI796 tRNA
  2. Saccharomyces cerevisiae tRNA-OTHER
  3. Saccharomyces cerevisiae EC1118 tRNA-Ser
  4. Saccharomyces cerevisiae FostersB tRNA
  5. Saccharomyces cerevisiae FostersO tRNA
  6. Saccharomyces cerevisiae Lalvin QA23 tRNA
  7. Saccharomyces cerevisiae R008 tRNA-Ser
  8. Saccharomyces cerevisiae R103 tRNA-Ser
  9. Saccharomyces cerevisiae RM11-1a tRNA-Ser
  10. Saccharomyces cerevisiae S288C tRNA-Ser
  11. Saccharomyces cerevisiae Vin13 tRNA
  12. Saccharomyces cerevisiae VL3 tRNA
  13. Saccharomyces pastorianus tRNA-Ser
2D structure