Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila virilis miR-7-RA URS000057228A_7244

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAAGACUAGUGAUUUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Chrysemys picta cpi-miR-7a-5p
  2. Drosophila ananassae miR-7-RA
  3. Drosophila mojavensis miR-7-RA
  4. Drosophila persimilis miR-7-RA
  5. Drosophila willistoni miR-7-RA
  6. Drosophila yakuba miR-7-RA
  7. Gorilla gorilla gorilla ggo-miR-7 (MIR7-1)
  8. Gorilla gorilla (western gorilla) ggo-miR-7
  9. Homo sapiens microRNA mir-7-1
  10. Lagothrix lagotricha lla-miR-7
  11. Macaca nemestrina mne-miR-7
  12. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-33731896
  13. Pan paniscus (pygmy chimpanzee) ppa-miR-7
  14. Pan troglodytes microRNA mir-7-3
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-7
  16. Saguinus labiatus (red-chested mustached tamarin) sla-miR-7
  17. Spodoptera frugiperda (fall armyworm) sfr-miR-7-5p
  18. Takifugu rubripes (torafugu) fru-miR-7
  19. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2411928