Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Callosobruchus chinensis (azuki bean weevil) hypothetical protein secondary structure diagram

Callosobruchus chinensis (azuki bean weevil) hypothetical protein URS0000562905_146774

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCGGGUAGCUCAGUCGGUAGAGCAUUGGACUUUUAAUCCAAGGGUCCAGGGUUCAAGUCCCUGCUCGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Aethina tumida (Small hive beetle) transfer RNA lysine (anticodon UUU)
  3. Agrilus planipennis (Emerald ash borer) tRNA-Lys
  4. Anthonomus grandis grandis (Boll weevil) transfer RNA lysine (anticodon UUU)
  5. Aromia moschata tRNA-Lys
  6. Bactrocera dorsalis tRNA-Lys
  7. Bactrocera latifrons (Solanum fruit fly) tRNA-Lys
  8. Bactrocera tryoni (Queensland fruitfly) tRNA-Lys
  9. Bos taurus tRNA-Lys (TTT) (tRNA-Lys-TTT-29-1)
  10. Callosobruchus analis hypothetical protein
  11. Ceratitis capitata (Mediterranean fruit fly) tRNA-Lys
  12. Dendroctonus ponderosae tRNA-Lys
  13. Diabrotica virgifera virgifera transfer RNA lysine (anticodon UUU)
  14. Drosophila ananassae tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  15. Drosophila busckii tRNA
  16. Drosophila erecta tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1)
  17. Drosophila ficusphila tRNA
  18. Drosophila grimshawi tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  19. Drosophila guanche tRNA.Lys
  20. Drosophila gunungcola tRNA-OTHER
  21. Drosophila melanogaster transfer RNA:Lysine-TTT 1-1 (Dmel_CR31899)
  22. Drosophila mojavensis tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  23. Drosophila persimilis tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 4)
  24. Drosophila pseudoobscura pseudoobscura tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  25. Drosophila simulans tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1)
  26. Drosophila virilis tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 10)
  27. Drosophila willistoni tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  28. Drosophila yakuba tRNA-Lys (TTT) (tRNA-Lys-TTT-2-1)
  29. Exocentrus adspersus tRNA-Lys
  30. Glossina austeni tRNA tRNA-Lys
  31. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Lys
  32. Glossina fuscipes fuscipes tRNA
  33. Glossina morsitans morsitans tRNA
  34. Glossina pallidipes tRNA
  35. Glossina palpalis gambiensis tRNA
  36. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Lys
  37. Lucilia cuprina tRNA-Lys for anticodon UUU
  38. Lutzomyia longipalpis tRNA tRNA-Lys
  39. Molorchus minor tRNA-Lys
  40. Musca domestica tRNA MDOA002367
  41. Onthophagus taurus (Dung beetle) tRNA-Lys
  42. Oryctes borbonicus tRNA
  43. Phlebotomus papatasi (Sand fly) tRNA tRNA-Lys
  44. Rhagoletis pomonella tRNA-Lys
  45. Rhamnusium bicolor tRNA-OTHER
  46. Sitophilus oryzae tRNA-Lys
  47. Stomoxys calcitrans tRNA-Lys
  48. Tribolium castaneum tRNA-Lys for anticodon UUU
2D structure