Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Glossina pallidipes tRNA secondary structure diagram

Glossina pallidipes tRNA URS00005612A3_7398

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGAUGUAGCUCAGAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUACGGGGAUCGAUGCCCCGCAUCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Aedes aegypti tRNA
  2. Aedes albopictus (Asian tiger mosquito) tRNA
  3. Anopheles arabiensis (Southern African malaria mosquito) tRNA
  4. Anopheles atroparvus tRNA
  5. Anopheles epiroticus tRNA
  6. Anopheles merus tRNA
  7. Anopheles quadriannulatus tRNA
  8. Bactrocera dorsalis tRNA-Ala
  9. Bactrocera latifrons (Solanum fruit fly) tRNA-Ala
  10. Bactrocera tryoni (Queensland fruitfly) tRNA-Ala
  11. Ceratitis capitata (Mediterranean fruit fly) tRNA-Ala
  12. Culex quinquefasciatus tRNA-Ala
  13. Drosophila busckii tRNA
  14. Drosophila erecta tRNA-Ala (AGC) (tRNA-Ala-AGC-1 1 to 10)
  15. Drosophila ficusphila tRNA
  16. Drosophila grimshawi tRNA-Ala (AGC) (tRNA-Ala-AGC-1-1, tRNA-Ala-AGC-1-2)
  17. Drosophila guanche tRNA.Ala
  18. Drosophila gunungcola tRNA-OTHER
  19. Drosophila melanogaster transfer RNA:Alanine-AGC 2-11 (multiple genes)
  20. Drosophila mojavensis tRNA-Ala (AGC) (tRNA-Ala-AGC-1 1 to 7)
  21. Drosophila persimilis tRNA-Ala (AGC) (tRNA-Ala-AGC-1 1 to 12)
  22. Drosophila pseudoobscura pseudoobscura tRNA-Ala (AGC) (tRNA-Ala-AGC-1 1 to 12)
  23. Drosophila sechellia tRNA-Ala (AGC) (tRNA-Ala-AGC-1 1 to 13)
  24. Drosophila simulans tRNA-Ala (AGC) (tRNA-Ala-AGC-1 1 to 12)
  25. Drosophila virilis tRNA-Ala (AGC) (tRNA-Ala-AGC-1 1 to 9)
  26. Drosophila willistoni tRNA-Ala (AGC) (tRNA-Ala-AGC-1 1 to 11)
  27. Drosophila yakuba tRNA-Ala (AGC) (tRNA-Ala-AGC-1 1 to 15)
  28. Eumeta japonica tRNA-Ala
  29. Glossina austeni tRNA
  30. Glossina brevipalpis tRNA
  31. Glossina fuscipes fuscipes tRNA
  32. Glossina morsitans morsitans tRNA
  33. Glossina palpalis gambiensis tRNA
  34. Lucilia cuprina tRNA-Ala
  35. Megaselia scalaris tRNA
  36. Musca domestica tRNA MDOA012467
  37. Rhagoletis pomonella tRNA-Ala
  38. Stomoxys calcitrans tRNA-Ala
2D structure Publications