Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-874 URS00005609ED_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-874: Bta-mir-874 is a downregulated miRNA that is considered a master regulator in the context of immune genes [PMC9445238]. It has been found to potentially regulate the expression of BCL2A1 [PMC7020904]. Additionally, bta-mir-874 has been shown to directly regulate the expression of PPARĪ±, a transcription factor in the PPAR signaling pathway that is involved in lipid metabolism and fat deposition [PMC5341059]. Bta-mir-874 has also been found to have a high number of target genes, indicating its potential regulatory role [PMC6162677]. The alignment and phylogenetic analysis of bta-mir-874 have shown its conservation between cow, mouse, and megabat [PMC8578396]. Furthermore, bta-mir-874 has been associated with fat levels in beef cattle [PMC8578396]. In summary, bta-mir-874 is a downregulated miRNA that plays a role in immune gene regulation and potentially regulates the expression of BCL2A1. It also directly regulates PPARĪ± and is associated with fat levels. The conservation and evolutionary analysis suggest its importance across different species.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCCCUGGCCCGAGGGACCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Canis lupus familiaris cfa-miR-874
  2. Equus caballus (horse) eca-miR-874
  3. Gorilla gorilla gorilla ggo-miR-874 (MIR874)
  4. Gorilla gorilla ggo-miR-874
  5. Homo sapiens (human) hsa-miR-874-3p
  6. Macaca mulatta (Rhesus monkey) mml-miR-874-3p
  7. Mus musculus (house mouse) mmu-miR-874-3p
  8. Pan troglodytes ptr-miR-874
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-874
  10. Rattus norvegicus rno-miR-874-3p
Publications