Daubentonia madagascariensis (aye-aye) dma-miR-143

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Daubentonia madagascariensis (aye-aye) dma-miR-143 URS000055F35D_31869

22 nucleotides
1 database (miRBase)
Found in 11 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGAGAUGAAGCACUGUAGCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Capra hircus miR-143
Gorilla gorilla gorilla ggo-miR-143 (MIR143)
Gorilla gorilla ggo-miR-143
Lagothrix lagotricha (brown woolly monkey) lla-miR-143
Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8254231
Ophiophagus hannah (king cobra) oha-miR-143-3p
Ovis aries (sheep) miscellaneous RNA
Pan paniscus (pygmy chimpanzee) ppa-miR-143
Pan troglodytes ptr-miR-143
Pongo pygmaeus (Bornean orangutan) ppy-miR-143
Rattus norvegicus rno-miR-143-3p

Publications