v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-10a-5p URS000055DE1B_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-10a: Gga-mir-10a is a microRNA that has been found to be abundantly expressed in the ovaries of laying chickens [PMC9563710]. In a sexually mature chicken ovary library, gga-mir-10a was one of the most frequently sequenced miRNAs, along with gga-miR-21 [PMC3700833]. It was also the most abundant miRNA in the mature ovary, with 1,177,256 reads [PMC3700833]. Gga-mir-10a was found to be dominantly expressed in two libraries and was one of the top 10 abundant miRNAs [PMC3700833] [PMC4326283]. In contrast, gga-mir-10a was not expressed in skeletal muscle according to expression atlas data [PMC8774586]. Gga-miR-1306-5p has also been studied for its role in mediating the innate host response of chickens against pathogens [PMC6998359]. Additionally, gga-mir-10a and gga-miR-10b were found to be the most abundant miRNAs across 18 libraries [PMC5520360].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UACCCUGUAGAUCCGAAUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 57 other species

  1. Aedes aegypti Aae-Mir-10-P1-v2_5p (mature (guide))
  2. Alligator mississippiensis Ami-Mir-10-P1c-v1_5p (mature (guide))
  3. Anolis carolinensis Aca-Mir-10-P1c-v1_5p (mature (guide))
  4. Blattella germanica Bge-Mir-10-P1-v2_5p (mature (guide))
  5. Bos taurus Bta-Mir-10-P1c-v1_5p (mature (guide))
  6. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-10a-5p
  7. Callithrix jacchus cja-miR-10a
  8. Callorhinchus milii eshark_mir-10_2
  9. Canis lupus familiaris cfa-miR-10a
  10. Capra hircus chi-miR-10a-5p
  11. Chiloscyllium plagiosum microRNA cpl-miR-10a-5p
  12. Chrysemys picta bellii Cpi-Mir-10-P1c-v1_5p (mature (guide))
  13. Chrysemys picta (Painted turtle) cpi-miR-10a-5p
  14. Columba livia Cli-Mir-10-P1c-v1_5p (mature (guide))
  15. Crassostrea gigas (Pacific oyster) Cgi-Mir-10-P1_5p (mature (guide))
  16. Cricetulus griseus cgr-miR-10a-5p
  17. Danio rerio (zebrafish) dre-miR-10a-5p
  18. Daphnia magna Dma-Mir-10-P1-v2_5p (mature (guide))
  19. Daphnia pulex (common water flea) dpu-miR-10
  20. Dasypus novemcinctus Dno-Mir-10-P1c-v1_5p (mature (guide))
  21. Dinoponera quadriceps dqu-miR-10-5p
  22. Echinops telfairi Ete-Mir-10-P1c-v1_5p (mature (guide))
  23. Gadus morhua gmo-miR-10d-5p
  24. Heliconius melpomene (postman butterfly) Hme-Mir-10-P1-v2_5p (mature (guide))
  25. Homo sapiens (human) Hsa-Mir-10-P1c-v1_5p (mature (guide))
  26. Ictalurus punctatus ipu-miR-10a
  27. Ixodes ricinus iri-miR-10a-5p
  28. Ixodes scapularis isc-miR-10
  29. Latimeria chalumnae (coelacanth) Lch-Mir-10-P1c_5p (mature (guide))
  30. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P1c-v1_5p (mature (guide))
  31. Limulus polyphemus Lpo-Mir-10-P1k-v2_5p (mature (guide))
  32. Locusta migratoria (migratory locust) lmi-miR-10-5p
  33. Lottia gigantea (owl limpet) lgi-miR-10
  34. Macaca mulatta (Rhesus monkey) Mml-Mir-10-P1c-v1_5p (mature (guide))
  35. Microcebus murinus (gray mouse lemur) mmr-miR-10a
  36. Monodelphis domestica Mdo-Mir-10-P1c-v1_5p (mature (guide))
  37. Mus musculus (house mouse) Mmu-Mir-10-P1c-v1_5p (mature (guide))
  38. Nautilus pompilius Npo-Mir-10-P1_5p (mature (guide))
  39. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-10a
  40. Ornithorhynchus anatinus (platypus) oan-miR-10a-5p
  41. Oryctolagus cuniculus (rabbit) ocu-miR-10a-5p
  42. Otolemur garnettii oga-miR-10a
  43. Papio hamadryas (hamadryas baboon) pha-miR-10a
  44. Parasteatoda tepidariorum pte-miR-10-5p
  45. Penaeus japonicus miR-10a
  46. Plutella xylostella pxy-miR-10-5p
  47. Pteropus alecto (black flying fox) pal-miR-10a-5p
  48. Rattus norvegicus Rno-Mir-10-P1c-v1_5p (mature (guide))
  49. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-10a
  50. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-10-P1c-v1_5p (mature (guide))
  51. Spodoptera frugiperda (fall armyworm) sfr-miR-10-5p
  52. Sus scrofa (pig) ssc-miR-10a-5p
  53. Taeniopygia guttata (zebra finch) Tgu-Mir-10-P1c-v1_5p (mature (guide))
  54. Tor tambroides (Thai mahseer) miR-10a-5p
  55. Tribolium castaneum tca-miR-10-5p
  56. Triops cancriformis tcf-miR-10-5p
  57. Xenopus laevis xla-miR-10a
 Publications