Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C 5S ribosomal RNA secondary structure diagram

Saccharomyces cerevisiae S288C 5S ribosomal RNA URS000055688D_559292

Automated summary: This rRNA sequence is 121 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 6 databases (RefSeq, IntAct, ENA, Rfam, PDBe, SGD). Described in 166 papers. Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (5S_rRNA, RF00001). Saccharomyces cerevisiae S288C 5S ribosomal RNA sequence is a product of RDN5-1, RDN5-6 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 3

According to IntAct, Saccharomyces cerevisiae S288C 5S ribosomal RNA interacts with:

IntAct ID Participant Synonyms
EBI-11016315 URS00004943D6_559292 EBI-10921915 URS00004943D6_559292 snr4 yeast
EBI-11621335 P46948 D6VUX7 EBI-1788 ECM20 Extracellular mutant protein 20 G7587 P46948 RRP41 Ribosomal RNA-processing protein 41 SKI6 Superkiller protein 6 YGR195W rrp41_yeast
EBI-11621400 P53632 D6W1V2 DNA polymerase kappa DNA polymerase sigma EBI-19517 HRC584 O0716 P53632 PAP2 TRF4 Topoisomerase 1-related protein TRF4 YOL115W pap2_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGUUGCGGCCAUAUCUACCAGAAAGCACCGUUUCCCGUCCGAUCAACUGUAGUUAAGCUGGUAAGAGCCUGACCGAGUAGUGUAGUGGGUGACCAUACGCGAAACUCAGGUGCUGCAAUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 212 other species

    1. Saccharomyces cerevisiae W303 5S ribosomal RNA from Saccharomyces cerevisiae W303 (PDB 3J6X, chain 5S)
    2. Actinomyces oris 5S ribosomal RNA
    3. Aestuariibacter sp. GS-14 5S ribosomal RNA
    4. Akkermansia sp. BIOML-A1 5S ribosomal RNA
    5. Aspergillus carbonarius ITEM 5010 5S ribosomal RNA
    6. Peribacillus simplex 5S ribosomal RNA
    7. Phocaeicola dorei 5S ribosomal RNA
    8. Bacteroides fragilis 5S ribosomal RNA
    9. Bacteroides ovatus 5S ribosomal RNA
    10. Bacteroides salyersiae 5S ribosomal RNA
    11. Bacteroides thetaiotaomicron 5S ribosomal RNA
    12. Bacteroides uniformis 5S ribosomal RNA
    13. Phocaeicola vulgatus 5S ribosomal RNA
    14. Bacteroides xylanisolvens 5S ribosomal RNA
    15. Bifidobacterium adolescentis 5S ribosomal RNA
    16. Bifidobacterium asteroides 5S ribosomal RNA
    17. Bifidobacterium bifidum 5S ribosomal RNA
    18. Bifidobacterium longum 5S ribosomal RNA
    19. Bifidobacterium pseudocatenulatum 5S ribosomal RNA
    20. Blautia wexlerae 5S ribosomal RNA
    21. Blumeria graminis f. sp. hordei DH14 5S ribosomal RNA
    22. Brachyspira hampsonii 5S ribosomal RNA
    23. Campylobacter mucosalis 5S ribosomal RNA
    24. Citrobacter amalonaticus 5S ribosomal RNA
    25. Clostridium botulinum 5S ribosomal RNA
    26. Clostridium sp. BIOML-A1 5S ribosomal RNA
    27. Collinsella sp. BIOML-A1 5S ribosomal RNA
    28. Collinsella sp. BIOML-A2 5S ribosomal RNA
    29. Corallococcus sp. H22C18031201 5S ribosomal RNA
    30. Drosophila ficusphila 5S ribosomal RNA
    31. Drosophila simulans 5S ribosomal RNA
    32. Eggerthella sp. BIOML-A1 5S ribosomal RNA
    33. Eggerthella sp. BIOML-A3 5S ribosomal RNA
    34. Eggerthella sp. BIOML-A4 5S ribosomal RNA
    35. Eggerthella sp. BIOML-A5 5S ribosomal RNA
    36. Enterococcus avium 5S ribosomal RNA
    37. Enterococcus durans 5S ribosomal RNA
    38. Enterococcus faecalis 5S ribosomal RNA
    39. Enterococcus hirae 5S ribosomal RNA
    40. Enterococcus mundtii 5S ribosomal RNA
    41. Eremothecium cymbalariae DBVPG#7215 5S ribosomal RNA
    42. Eremothecium gossypii 5S ribosomal RNA
    43. Eremothecium gossypii ATCC 10895 5S ribosomal RNA copy 23 (AGOS_RDN5_23)
    44. Eremothecium gossypii FDAG1 5S ribosomal RNA copy 20
    45. Eremothecium sinecaudum 5S_ribosomal_RNA_10
    46. Escherichia coli 5S ribosomal RNA
    47. Faecalibacterium prausnitzii 5S ribosomal RNA
    48. Glaesserella parasuis 5S ribosomal RNA
    49. Gordonibacter urolithinfaciens 5S ribosomal RNA
    50. Hordeum vulgare subsp. vulgare (two-rowed barley) 5S ribosomal RNA
    51. Capillibacterium thermochitinicola 5S ribosomal RNA
    52. Kazachstania africana CBS 2517 5S ribosomal RNA
    53. Kazachstania barnettii 5S-rRNA
    54. Kazachstania naganishii CBS 8797 5S ribosomal RNA
    55. Kazachstania saulgeensis 5S ribosomal RNA
    56. Klebsiella oxytoca 5S ribosomal RNA
    57. Kluyveromyces dobzhanskii CBS 2104 5S rRNA
    58. Kluyveromyces marxianus DMKU3-1042 5S ribosomal RNA
    59. Kluyveromyces marxianus ribosomal RNA-5S
    60. Rothia koreensis 5S ribosomal RNA
    61. Kocuria sediminis 5S ribosomal RNA
    62. Lachancea dasiensis 5S ribosomal RNA
    63. Lachancea fermentati 5S ribosomal RNA
    64. Lachancea lanzarotensis 5S ribosomal RNA
    65. Lachancea meyersii CBS 8951 ribosomal RNA
    66. Lachancea mirantina 5S ribosomal RNA
    67. Lachancea nothofagi CBS 11611 5S ribosomal RNA
    68. Lachancea quebecensis ribosomal RNA
    69. Lachancea sp. CBS 6924 ribosomal RNA
    70. Lachancea thermotolerans CBS 6340 5S ribosomal RNA
    71. Lachnospira eligens 5S ribosomal RNA
    72. Lentilactobacillus kefiri 5S ribosomal RNA
    73. Lentilactobacillus parakefiri 5S ribosomal RNA
    74. Lacticaseibacillus rhamnosus 5S ribosomal RNA
    75. Leptomonas seymouri 5S ribosomal RNA
    76. Leuconostoc lactis 5S ribosomal RNA
    77. Leuconostoc mesenteroides 5S ribosomal RNA
    78. Muricauda olearia 5S ribosomal RNA
    79. Naumovozyma castellii CBS 4309 5S ribosomal RNA
    80. Naumovozyma dairenensis CBS 421 5S ribosomal RNA
    81. Parabacteroides distasonis 5S ribosomal RNA
    82. Parabacteroides merdae 5S ribosomal RNA
    83. Parasutterella excrementihominis 5S ribosomal RNA
    84. Phascolarctobacterium faecium 5S ribosomal RNA
    85. Proteus mirabilis 5S ribosomal RNA
    86. Pseudoalteromonas piscicida 5S ribosomal RNA
    87. Kluyveromyces lactis RNA (121-MER) from Kluyveromyces lactis (PDB 6UZ7, chain 7)
    88. Rothia dentocariosa 5S ribosomal RNA
    89. Rothia sp. Olga 5S ribosomal RNA
    90. [Ruminococcus] torques 5S ribosomal RNA
    91. Saccharomyces cerevisiae 5S rRNA
    92. Saccharomyces cerevisiae AWRI796 5S ribosomal RNA
    93. Saccharomyces cerevisiae EC1118 RDN5-2
    94. Saccharomyces cerevisiae Kyokai no. 7 5S rRNA
    95. Saccharomyces cerevisiae PE-2 RDN5-1
    96. Saccharomyces cerevisiae Vin13 5S ribosomal RNA
    97. Saccharomyces cerevisiae YJM1078 RDN5-23
    98. Saccharomyces cerevisiae YJM1083 RDN5-24
    99. Saccharomyces cerevisiae YJM1129 RDN5-30
    100. Saccharomyces cerevisiae YJM1133 RDN5-20
    101. Saccharomyces cerevisiae YJM1190 RDN5-23
    102. Saccharomyces cerevisiae YJM1199 RDN5-20
    103. Saccharomyces cerevisiae YJM1202 RDN5-34
    104. Saccharomyces cerevisiae YJM1208 RDN5-134
    105. Saccharomyces cerevisiae YJM1242 RDN5-30
    106. Saccharomyces cerevisiae YJM1244 RDN5-103
    107. Saccharomyces cerevisiae YJM1248 RDN5-103
    108. Saccharomyces cerevisiae YJM1250 RDN5-34
    109. Saccharomyces cerevisiae YJM1252 RDN5-103
    110. Saccharomyces cerevisiae YJM1273 RDN5-40
    111. Saccharomyces cerevisiae YJM1304 RDN5-26
    112. Saccharomyces cerevisiae YJM1307 RDN5-124
    113. Saccharomyces cerevisiae YJM1311 RDN5-20
    114. Saccharomyces cerevisiae YJM1326 RDN5-40
    115. Saccharomyces cerevisiae YJM1332 RDN5-40
    116. Saccharomyces cerevisiae YJM1336 RDN5-102
    117. Saccharomyces cerevisiae YJM1338 RDN5-20
    118. Saccharomyces cerevisiae YJM1341 RDN5-20
    119. Saccharomyces cerevisiae YJM1342 RDN5-60
    120. Saccharomyces cerevisiae YJM1355 RDN5-102
    121. Saccharomyces cerevisiae YJM1356 RDN5-102
    122. Saccharomyces cerevisiae YJM1381 RDN5-20
    123. Saccharomyces cerevisiae YJM1383 RDN5-20
    124. Saccharomyces cerevisiae YJM1385 RDN5-102
    125. Saccharomyces cerevisiae YJM1386 RDN5-20
    126. Saccharomyces cerevisiae YJM1387 RDN5-102
    127. Saccharomyces cerevisiae YJM1388 RDN5-102
    128. Saccharomyces cerevisiae YJM1389 RDN5-20
    129. Saccharomyces cerevisiae YJM1399 RDN5-20
    130. Saccharomyces cerevisiae YJM1400 RDN5-23
    131. Saccharomyces cerevisiae YJM1401 RDN5-23
    132. Saccharomyces cerevisiae YJM1402 RDN5-36
    133. Saccharomyces cerevisiae YJM1415 RDN5-20
    134. Saccharomyces cerevisiae YJM1417 RDN5-20
    135. Saccharomyces cerevisiae YJM1418 RDN5-20
    136. Saccharomyces cerevisiae YJM1419 RDN5-203
    137. Saccharomyces cerevisiae YJM1433 RDN5-102
    138. Saccharomyces cerevisiae YJM1434 RDN5-20
    139. Saccharomyces cerevisiae YJM1439 RDN5-102
    140. Saccharomyces cerevisiae YJM1443 RDN5-20
    141. Saccharomyces cerevisiae YJM1444 RDN5-20
    142. Saccharomyces cerevisiae YJM1447 RDN5-20
    143. Saccharomyces cerevisiae YJM1450 RDN5-123
    144. Saccharomyces cerevisiae YJM1460 RDN5-123
    145. Saccharomyces cerevisiae YJM1463 RDN5-102
    146. Saccharomyces cerevisiae YJM1477 RDN5-20
    147. Saccharomyces cerevisiae YJM1478 RDN5-102
    148. Saccharomyces cerevisiae YJM1479 RDN5-20
    149. Saccharomyces cerevisiae YJM1526 RDN5-30
    150. Saccharomyces cerevisiae YJM1527 RDN5-103
    151. Saccharomyces cerevisiae YJM1549 RDN5-102
    152. Saccharomyces cerevisiae YJM1573 RDN5-20
    153. Saccharomyces cerevisiae YJM1574 RDN5-20
    154. Saccharomyces cerevisiae YJM1592 RDN5-30
    155. Saccharomyces cerevisiae YJM1615 RDN5-20
    156. Saccharomyces cerevisiae YJM189 RDN5-20
    157. Saccharomyces cerevisiae YJM193 RDN5-102
    158. Saccharomyces cerevisiae YJM195 RDN5-102
    159. Saccharomyces cerevisiae YJM244 RDN5-103
    160. Saccharomyces cerevisiae YJM248 RDN5-10
    161. Saccharomyces cerevisiae YJM270 RDN5-13
    162. Saccharomyces cerevisiae YJM271 RDN5-103
    163. Saccharomyces cerevisiae YJM320 RDN5-146
    164. Saccharomyces cerevisiae YJM326 RDN5-10
    165. Saccharomyces cerevisiae YJM428 RDN5-10
    166. Saccharomyces cerevisiae YJM450 RDN5-12
    167. Saccharomyces cerevisiae YJM451 RDN5-20
    168. Saccharomyces cerevisiae YJM453 RDN5-102
    169. Saccharomyces cerevisiae YJM456 RDN5-10
    170. Saccharomyces cerevisiae YJM470 RDN5-102
    171. Saccharomyces cerevisiae YJM541 RDN5-102
    172. Saccharomyces cerevisiae YJM554 RDN5-102
    173. Saccharomyces cerevisiae YJM555 RDN5-102
    174. Saccharomyces cerevisiae YJM627 RDN5-103
    175. Saccharomyces cerevisiae YJM681 RDN5-20
    176. Saccharomyces cerevisiae YJM682 RDN5-10
    177. Saccharomyces cerevisiae YJM683 RDN5-10
    178. Saccharomyces cerevisiae YJM689 RDN5-10
    179. Saccharomyces cerevisiae YJM693 RDN5-102
    180. Saccharomyces cerevisiae YJM969 RDN5-10
    181. Saccharomyces cerevisiae YJM972 RDN5-103
    182. Saccharomyces cerevisiae YJM975 RDN5-10
    183. Saccharomyces cerevisiae YJM978 RDN5-102
    184. Saccharomyces cerevisiae YJM981 RDN5-102
    185. Saccharomyces cerevisiae YJM984 RDN5-102
    186. Saccharomyces cerevisiae YJM987 RDN5-102
    187. Saccharomyces cerevisiae YJM990 RDN5-12
    188. Saccharomyces cerevisiae YJM993 RDN5-10
    189. Saccharomyces cerevisiae YJM996 RDN5-102
    190. Saccharomyces kudriavzevii IFO 1802 5S ribosomal RNA
    191. Saccharomyces paradoxus NRRL Y-17217 5S rRNA
    192. Salmonella enterica 5S ribosomal RNA
    193. Shigella flexneri 2a 5S ribosomal RNA
    194. Staphylococcus pseudintermedius 5S ribosomal RNA
    195. Streptococcus anginosus 5S ribosomal RNA
    196. Streptococcus mutans N3209 5S ribosomal RNA
    197. Streptococcus mutans U138 5S ribosomal RNA
    198. Streptococcus pneumoniae SP6-BS73 5S ribosomal RNA
    199. Streptococcus salivarius 5S ribosomal RNA
    200. Kitasatospora aureofaciens 5S ribosomal RNA
    201. synthetic construct 5S ribosomal RNA
    202. Thalassotalea litorea 5S ribosomal RNA
    203. Thalassotalea mangrovi 5S ribosomal RNA
    204. Torulaspora delbrueckii 5S ribosomal RNA
    205. Torulaspora delbrueckii CBS 1146 5S ribosomal RNA
    206. Torulaspora globosa 5S ribosomal RNA
    207. Torulaspora sp. CBS 2947 5S ribosomal RNA
    208. Turicibacter sanguinis 5S ribosomal RNA
    209. Vanderwaltozyma polyspora DSM 70294 5S ribosomal RNA
    210. Veillonella parvula 5S ribosomal RNA
    211. Vibrio anguillarum 5S ribosomal RNA
    212. Xanthomonas citri pv. citri 5S ribosomal RNA
    213. Zygotorulaspora mrakii 5S ribosomal RNA
    2D structure New