Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4326 URS0000555DA6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4326: Hsa-mir-4326 is a microRNA that has been studied in various contexts [PMC9556953]. In a study related to invasive NFPA, hsa-mir-4326 was found to have high connectivity in the ceRNA regulatory network [PMC9556953]. The expression of hsa-mir-4326 was analyzed in colorectal cancer (CRC) and it was found to be significantly down-regulated compared to normal samples [PMC7678213]. Target genes of hsa-mir-4326 were predicted using TargetScan [PMC7678213]. A circRNA-miRNA-mRNA regulatory network involving hsa_circ_0004831, hsa-mir-4326, and 12 mRNAs was visualized using Cytoscape [PMC7678213]. Hsa-mir-4326 was identified to be regulated by hsa_circ_0004831 through a competitive endogenous RNA mechanism [PMC7678213]. Hsa-mir-4326 and another microRNA, hsa-miR-4433b-3p, were found to have high reliability in their expression levels [PMC6823392]. In the context of severe RSV-associated pneumonia in children, hsa-mir-4326 was downregulated compared to samples from children with mild RSV-associated pneumonia [PMC7211260]. The expression of five miRNAs, including hsa-mir-4326, was verified by RT-qPCR [PMC7107905].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUUCCUCUGUCUCCCAGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications