v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) ppa-miR-210 URS000055128B_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGUGCGUGUGACAGCGGCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Bos taurus (domestic cattle) Bta-Mir-210_3p (mature (guide))
  2. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-210-5p
  3. Branchiostoma floridae (Florida lancelet) bfl-miR-210-3p
  4. Branchiostoma lanceolatum Bla-Mir-210_3p (mature (guide))
  5. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-210_3p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-210_3p (mature (guide))
  7. Capra hircus (goat) miR-210
  8. Cavia porcellus (domestic guinea pig) cpo-miR-210-3p
  9. Cricetulus griseus cgr-miR-210-3p
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-210-3p
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-210_3p (mature (guide))
  12. Equus caballus (horse) Eca-Mir-210_3p (mature (guide))
  13. Gorilla gorilla gorilla ggo-miR-210 (MIR210)
  14. Gorilla gorilla (western gorilla) ggo-miR-210
  15. Homo sapiens hsa-miR-210-3p
  16. Macaca mulatta mml-miR-210-3p
  17. Microcebus murinus (gray mouse lemur) Mmr-Mir-210_3p (mature (guide))
  18. Mus musculus (house mouse) mmu-miR-210-3p
  19. Nomascus leucogenys nle-miR-210
  20. Oryctolagus cuniculus Ocu-Mir-210_3p (mature (guide))
  21. Otolemur garnettii oga-miR-210
  22. Ovis aries miscellaneous RNA
  23. Pan troglodytes (chimpanzee) ptr-miR-210
  24. Papio hamadryas pha-miR-210
  25. Pongo abelii (Sumatran orangutan) Pab-Mir-210_3p (mature (guide))
  26. Rattus norvegicus rno-miR-210-3p
  27. Sus scrofa ssc-miR-210
  28. Tupaia chinensis tch-miR-210
 Relationships

Molecular Relationships

 Publications