Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-452 URS0000550C66_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACUGUUUGCAGAGGAAACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-452
  2. Gorilla gorilla gorilla ggo-miR-452 (MIR452)
  3. Gorilla gorilla ggo-miR-452
  4. Homo sapiens hsa-miR-452-5p
  5. Macaca mulatta (Rhesus monkey) mml-miR-452-5p
  6. Mus musculus Mus_musculus piRNA piR-mmu-33951122
  7. Pan troglodytes ptr-miR-452
  8. Pongo pygmaeus ppy-miR-452
  9. Pteropus alecto (black flying fox) pal-miR-452-5p
  10. Sus scrofa (pig) ssc-miR-452
Publications