Pan troglodytes (chimpanzee) small nucleolar RNA, C/D box 83A (ENSPTRG00000032723.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) small nucleolar RNA, C/D box 83A (ENSPTRG00000032723.2) URS000054DD16_9598

95 nucleotides
3 databases (ENA, Ensembl, Rfam)
Found in 1 other species
31 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GCUGUUCGUUGAUGAGGCUCAGAGUGAGCGCUGGGUACAGCGCCCGAAUCGGACAGUGUAGAACCAUUCUCUACUGCCUUCCUUCUGAGAACAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Homo sapiens small nucleolar RNA, C/D box 83A (SNORD83A)

2D structure

Publications