v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
RNA (74-MER) from Escherichia coli (PDB 1GTR, chain B) secondary structure diagram

RNA (74-MER) from Escherichia coli (PDB 1GTR, chain B) URS0000541BD0_562

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGGUAUCGCCAAGCGGUAAGGCACCGGAUUCUGAUUCCGGCAUUCCGAGGUUCGAAUCCUCGUACCCCAGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Escherichia coli O08 tRNA-Gln
  2. Klebsiella pneumoniae tRNA-Gln
  3. Klebsiella quasipneumoniae tRNA-Gln
  4. Salmonella enterica subsp. enterica serovar Agona str. ATCC BAA-707 tRNA-Gln
  5. Salmonella enterica subsp. enterica serovar Heidelberg str. N18453 tRNA-Gln
  6. Salmonella enterica subsp. enterica serovar Heidelberg str. N26457 tRNA-Gln
  7. Salmonella enterica subsp. enterica serovar Newport str. CVM 19447 tRNA-Gln
  8. Salmonella enterica subsp. enterica serovar Newport str. CVM 35199 tRNA-Gln
  9. Salmonella enterica subsp. enterica serovar Schwarzengrund tRNA-Gln
  10. Salmonella enterica subsp. enterica serovar Senftenberg str. 316235162 tRNA-Gln
  11. Salmonella enterica subsp. enterica serovar Typhimurium tRNA-Gln
  12. Salmonella enterica tRNA-Gln
  13. Salmonella sp. LSP 127/00 tRNA-Gln
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications