Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-31 URS00005416E3_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-31: Bta-mir-31 is a differentially expressed (DE) miRNA that has been identified in various studies. In a study analyzing udder parenchyma tissue infected with CoNS, bta-mir-31 was found to be DE, with upregulated expression during infection [PMC7937231]. Another study focused on serum samples identified bta-mir-31 as one of the differentially expressed miRNAs during both acute and persistent infection stages of FMDV [PMC5701639]. Additionally, bta-mir-31 was found to have a high expression level during FMDV persistence [PMC5701639]. In another analysis, bta-mir-31 was one of the miRNAs that showed significant fold changes in expression levels [PMC5384155]. Bta-mir-31 has also been associated with cellular proliferation and apoptosis [PMC5384155]. Furthermore, it was found to potentially target different regions of the FMDV A24 Cruzeiro RNA genome [PMC5384155]. Bta-mir-31 is encoded in intergenic regions and has immune modulatory functions [PMC5384155] as well. It has been shown to target CTSC and IL1B genes [PMC8511192] and is involved in ceRNA networks interacting with lncRNAs and mRNAs [PMC9613354]. Bta-mir-31 expression was also found to be higher in the FTA treatment group compared to controls [PMC7943879]. Overall, bta-mir-31 exhibits differential expression patterns during infection stages and plays various roles in cellular processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAAGAUGCUGGCAUAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Equus caballus eca-miR-31
  2. Homo sapiens (human) hsa-miR-31-5p
  3. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8098246
  4. Pteropus alecto pal-miR-31-5p
Publications