Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-1199-5p URS00005374D8_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-1199: Mmu-mir-1199 is a type of microRNA that was transfected into 4T1 cells along with other microRNAs using Lipofectamine 2000 and selected with Neomycin and Hygromycin [PMC5660124]. The human miR orthologue of mmu-mir-1199 has not been discovered yet [PMC3583619]. However, one clone was partially homologous to the mmu-mir-1199 precursor stem-loop [PMC3583619]. The role and target validations of mmu-mir-1199 are not yet known, and further studies are needed to identify them in both humans and mice [PMC3583619]. The sequence coding for mmu-mir-1199 is located on chromosome 8 between the Prkaca and Rln3 genes [PMC3583619]. In MLE-12 cells, mmu-miR-1946a was upregulated, while mmu-mir-1199 and mmu-miR-12196 were not detected [PMC8986370].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGAGUCCCGGUCGCGCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications