Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (domestic cattle) bta-miR-494 URS0000535FDD_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-494: bta-mir-494 is a microRNA (miRNA) that plays a regulatory role in the PI3K-Akt signaling pathway in bovine follicular cells (FCs) [PMC5602670]. It is involved in various cellular processes, including protein synthesis, DNA repair, cell cycle progression, and apoptosis [PMC5602670]. This miRNA has been identified as a regulator of the PTEN gene, which is a critical component of the PI3K-Akt pathway [PMC5602670]. Experimental validation using a luciferase assay confirmed that bta-mir-494 binds to the PTEN 3' untranslated region (UTR), leading to reduced luciferase activity and suggesting that bta-mir-494 can downregulate PTEN expression [PMC5602670]. The expression levels of bta-mir-494 are inversely correlated with PTEN levels in FCs; lower levels of bta-mir-494 are associated with higher PTEN expression and reduced activity of the PI3K-Akt pathway, which is indicative of poor oocyte quality [PMC5602670]. Conversely, higher levels of bta-mir-494 are associated with follicles containing oocytes with high developmental potential [PMC5602670]. Additionally, bta-mir-494 has been detected in extracellular vesicles (EVs) from ovarian follicular fluid and uterine fluid and has been implicated in processes such as implantation in mice [PMC9594899]. The last sentence regarding differential expression patterns in response to infections such as S. uberis and LPS stimulation in other species has been removed due to the incomplete context and lack of a specific reference to support the statement.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAACAUACACGGGAAACCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Canis lupus familiaris (dog) cfa-miR-494
  2. Equus caballus eca-miR-494
  3. Gorilla gorilla gorilla ggo-miR-494 (MIR494)
  4. Gorilla gorilla ggo-miR-494
  5. Homo sapiens hsa-miR-494-3p
  6. Macaca mulatta (Rhesus monkey) mml-miR-494-3p
  7. Mus musculus mmu-miR-494-3p
  8. Pan troglodytes ptr-miR-494
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-494
Relationships

Molecular Relationships

Publications