Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-494 URS0000535FDD_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-494: Bta-mir-494 is a regulator of PTEN in follicular cells and is involved in the PI3K-Akt signaling pathway [PMC5602670]. It is a microRNA that plays a role in various cellular processes such as protein synthesis, DNA repair, cell cycle progression, and apoptosis [PMC5602670]. In follicular cells with high oocyte developmental potential, there are lower levels of PTEN, FOXO3a, bta-mir-494, bta-miR-20a, and BAX [PMC5602670]. Bta-mir-494 regulates the levels of PTEN in follicular cells [PMC5602670]. The levels of bta-mir-494 and bta-miR-20a are significantly higher in follicular cells derived from follicles with cleaved oocytes compared to those without cleaved oocytes [PMC5602670]. The interaction between bta-mir-494 and the bovine PTEN 3’UTR has been experimentally validated using a luciferase assay [PMC5602670]. In poor oocyte quality groups, there are higher levels of PTEN mRNA and lower levels of bta-mir-494 and bta-miR-20a [PMC5602670]. Bta-mir-494 has also been detected in extracellular vesicles from various fluids such as ovarian fluid and uterine fluid [PMC9594899]. It has been associated with implantation in mice [PMC9594899]. In response to Gram-positive S. uberis infection, the expression of bta-mir-494 is down-regulated while it is up-regulated in response to LPS stimulation. This inverse response has also been observed for other microRNAs such as bta-miR-100 [PMC3589390].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAACAUACACGGGAAACCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Canis lupus familiaris cfa-miR-494
  2. Equus caballus (horse) eca-miR-494
  3. Gorilla gorilla gorilla ggo-miR-494 (MIR494)
  4. Gorilla gorilla ggo-miR-494
  5. Homo sapiens hsa-miR-494-3p
  6. Macaca mulatta (Rhesus monkey) mml-miR-494-3p
  7. Mus musculus mmu-miR-494-3p
  8. Pan troglodytes ptr-miR-494
  9. Pongo pygmaeus (Bornean orangutan) ppy-miR-494
Publications