Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Methionine tRNA (tRNA-Met), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Methionine tRNA (tRNA-Met), predicted by tRNAscan-SE analysis URS00005350CD_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (ENA, Rfam, SGD, IntAct, GtRNAdb). Described in 91 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Methionine tRNA (tRNA-Met), predicted by tRNAscan-SE analysis sequence is a product of tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2, tRNA-iMet-CAT-1-3, IMT1, IMT2, tRNA-iMet-CAT-1-4, IMT3, IMT4, tRNA-iMet-CAT-1-5 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 4

According to IntAct, Saccharomyces cerevisiae S288C Methionine tRNA (tRNA-Met), predicted by tRNAscan-SE analysis interacts with:

Interaction id Participant Synonyms
EBI-11711150 intact:EBI-11710314 EBI-11710314 Eukaryotic translation initiation factor 2 complex GCD11:SUI2:SUI3 IF-2 complex IF2 complex eIF-2 complex eIF2 complex eif2_yeast
EBI-11874009 intact:EBI-11710314 EBI-11710314 Eukaryotic translation initiation factor 2 complex GCD11:SUI2:SUI3 IF-2 complex IF2 complex eIF-2 complex eIF2 complex eif2_yeast
EBI-11874469 intact:EBI-11710314 EBI-11710314 Eukaryotic translation initiation factor 2 complex GCD11:SUI2:SUI3 IF-2 complex IF2 complex eIF-2 complex eIF2 complex eif2_yeast
EBI-11703262 P53331 D6VV53 EBI-23641 G9381 P53331 REX1 RNH70 RNase H(70) YGR276C rexo1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGCGCCGUGGCGCAGUGGAAGCGCGCAGGGCUCAUAACCCUGAUGUCCUCGGAUCGAAACCGAGCGGCGCUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 152 other species

    1. Kazachstania barnettii transfer RNA-iMet(CAT)
    2. Kazachstania naganishii CBS 8797 tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2)
    3. Kazachstania saulgeensis tRNA
    4. Kluyveromyces dobzhanskii CBS 2104 tRNA-Met
    5. Kluyveromyces lactis tRNA-iMet (CAT) (tRNA-iMet-CAT-2-1, tRNA-iMet-CAT-2-2)
    6. Kluyveromyces marxianus DMKU3-1042 tRNA
    7. Kluyveromyces marxianus tRNA-Met
    8. Kluyveromyces marxianus var. marxianus KCTC 17555 tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2)
    9. Lachancea dasiensis tRNA
    10. Lachancea dasiensis tRNA-Met (CAT) cove score=74.96
    11. Lachancea lanzarotensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    12. Lachancea meyersii CBS 8951 tRNA-Met (CAT) cove score=74.96
    13. Lachancea nothofagi CBS 11611 tRNA
    14. Lachancea sp. CBS 6924 tRNA-Met (CAT) cove score=74.96
    15. Naumovozyma castellii CBS 4309 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    16. Naumovozyma dairenensis CBS 421 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    17. Saccharomyces arboricola H-6 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    18. Saccharomyces boulardii (nom. inval.) tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    19. Saccharomyces cerevisiae AWRI796 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    20. Saccharomyces cerevisiae tM(CAT)OR1 - systematic name
    21. Saccharomyces cerevisiae CBS 7960 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    22. Saccharomyces cerevisiae CEN.PK113-7D tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    23. Saccharomyces cerevisiae CLIB215 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    24. Saccharomyces cerevisiae CLIB324 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 3)
    25. Saccharomyces cerevisiae CLIB382 tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2)
    26. Saccharomyces cerevisiae EC1118 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    27. Saccharomyces cerevisiae EC9-8 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    28. Saccharomyces cerevisiae FL100 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    29. Saccharomyces cerevisiae FostersB tRNA-iMet (CAT) (tRNA-iMet-CAT-2 1 to 3)
    30. Saccharomyces cerevisiae FostersO tRNA
    31. Saccharomyces cerevisiae Kyokai no. 7 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
    32. Saccharomyces cerevisiae Lalvin QA23 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    33. Saccharomyces cerevisiae P283 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    34. Saccharomyces cerevisiae P301 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    35. Saccharomyces cerevisiae PE-2 tRNA-iMet
    36. Saccharomyces cerevisiae PW5 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    37. Saccharomyces cerevisiae R008 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    38. Saccharomyces cerevisiae R103 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    39. Saccharomyces cerevisiae RM11-1a tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    40. Saccharomyces cerevisiae Sigma1278b tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    41. Saccharomyces cerevisiae T73 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    42. Saccharomyces cerevisiae T7 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    43. Saccharomyces cerevisiae UC5 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    44. Saccharomyces cerevisiae UFMG A-905 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    45. Saccharomyces cerevisiae Vin13 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    46. Saccharomyces cerevisiae VL3 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    47. Saccharomyces cerevisiae W303 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    48. Saccharomyces cerevisiae Y10 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 3)
    49. Saccharomyces cerevisiae YJM1078 tRNA-Met
    50. Saccharomyces cerevisiae YJM1083 tRNA-Met
    51. Saccharomyces cerevisiae YJM1129 tRNA-Met
    52. Saccharomyces cerevisiae YJM1133 tRNA-Met
    53. Saccharomyces cerevisiae YJM1190 tRNA-Met
    54. Saccharomyces cerevisiae YJM1199 tRNA-Met
    55. Saccharomyces cerevisiae YJM1202 tRNA-Met
    56. Saccharomyces cerevisiae YJM1208 tRNA-Met
    57. Saccharomyces cerevisiae YJM1242 tRNA-Met
    58. Saccharomyces cerevisiae YJM1244 tRNA-Met
    59. Saccharomyces cerevisiae YJM1248 tRNA-Met
    60. Saccharomyces cerevisiae YJM1250 tRNA-Met
    61. Saccharomyces cerevisiae YJM1252 tRNA-Met
    62. Saccharomyces cerevisiae YJM1273 tRNA-Met
    63. Saccharomyces cerevisiae YJM1304 tRNA-Met
    64. Saccharomyces cerevisiae YJM1307 tRNA-Met
    65. Saccharomyces cerevisiae YJM1311 tRNA-Met
    66. Saccharomyces cerevisiae YJM1326 tRNA-Met
    67. Saccharomyces cerevisiae YJM1332 tRNA-Met
    68. Saccharomyces cerevisiae YJM1336 tRNA-Met
    69. Saccharomyces cerevisiae YJM1338 tRNA-Met
    70. Saccharomyces cerevisiae YJM1341 tRNA-Met
    71. Saccharomyces cerevisiae YJM1342 tRNA-Met
    72. Saccharomyces cerevisiae YJM1355 tRNA-Met
    73. Saccharomyces cerevisiae YJM1356 tRNA-Met
    74. Saccharomyces cerevisiae YJM1381 tRNA-Met
    75. Saccharomyces cerevisiae YJM1383 tRNA-Met
    76. Saccharomyces cerevisiae YJM1385 tRNA-Met
    77. Saccharomyces cerevisiae YJM1386 tRNA-Met
    78. Saccharomyces cerevisiae YJM1387 tRNA-Met
    79. Saccharomyces cerevisiae YJM1388 tRNA-Met
    80. Saccharomyces cerevisiae YJM1389 tRNA-Met
    81. Saccharomyces cerevisiae YJM1399 tRNA-Met
    82. Saccharomyces cerevisiae YJM1400 tRNA-Met
    83. Saccharomyces cerevisiae YJM1401 tRNA-Met
    84. Saccharomyces cerevisiae YJM1402 tRNA-Met
    85. Saccharomyces cerevisiae YJM1415 tRNA-Met
    86. Saccharomyces cerevisiae YJM1417 tRNA-Met
    87. Saccharomyces cerevisiae YJM1418 tRNA-Met
    88. Saccharomyces cerevisiae YJM1419 tRNA-Met
    89. Saccharomyces cerevisiae YJM1433 tRNA-Met
    90. Saccharomyces cerevisiae YJM1434 tRNA-Met
    91. Saccharomyces cerevisiae YJM1439 tRNA-Met
    92. Saccharomyces cerevisiae YJM1443 tRNA-Met
    93. Saccharomyces cerevisiae YJM1444 tRNA-Met
    94. Saccharomyces cerevisiae YJM1447 tRNA-Met
    95. Saccharomyces cerevisiae YJM1450 tRNA-Met
    96. Saccharomyces cerevisiae YJM1460 tRNA-Met
    97. Saccharomyces cerevisiae YJM1463 tRNA-Met
    98. Saccharomyces cerevisiae YJM1477 tRNA-Met
    99. Saccharomyces cerevisiae YJM1478 tRNA-Met
    100. Saccharomyces cerevisiae YJM1479 tRNA-Met
    101. Saccharomyces cerevisiae YJM1526 tRNA-Met
    102. Saccharomyces cerevisiae YJM1527 tRNA-Met
    103. Saccharomyces cerevisiae YJM1549 tRNA-Met
    104. Saccharomyces cerevisiae YJM1573 tRNA-Met
    105. Saccharomyces cerevisiae YJM1574 tRNA-Met
    106. Saccharomyces cerevisiae YJM1592 tRNA-Met
    107. Saccharomyces cerevisiae YJM1615 tRNA-Met
    108. Saccharomyces cerevisiae YJM189 tRNA-Met
    109. Saccharomyces cerevisiae YJM193 tRNA-Met
    110. Saccharomyces cerevisiae YJM195 tRNA-Met
    111. Saccharomyces cerevisiae YJM244 tRNA-Met
    112. Saccharomyces cerevisiae YJM248 tRNA-Met
    113. Saccharomyces cerevisiae YJM269 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    114. Saccharomyces cerevisiae YJM270 tRNA-Met
    115. Saccharomyces cerevisiae YJM271 tRNA-Met
    116. Saccharomyces cerevisiae YJM320 tRNA-Met
    117. Saccharomyces cerevisiae YJM326 tRNA-Met
    118. Saccharomyces cerevisiae YJM428 tRNA-Met
    119. Saccharomyces cerevisiae YJM450 tRNA-Met
    120. Saccharomyces cerevisiae YJM451 tRNA-Met
    121. Saccharomyces cerevisiae YJM453 tRNA-Met
    122. Saccharomyces cerevisiae YJM456 tRNA-Met
    123. Saccharomyces cerevisiae YJM470 tRNA-Met
    124. Saccharomyces cerevisiae YJM541 tRNA-Met
    125. Saccharomyces cerevisiae YJM554 tRNA-Met
    126. Saccharomyces cerevisiae YJM555 tRNA-Met
    127. Saccharomyces cerevisiae YJM627 tRNA-Met
    128. Saccharomyces cerevisiae YJM681 tRNA-Met
    129. Saccharomyces cerevisiae YJM682 tRNA-Met
    130. Saccharomyces cerevisiae YJM683 tRNA-Met
    131. Saccharomyces cerevisiae YJM689 tRNA-Met
    132. Saccharomyces cerevisiae YJM693 tRNA-Met
    133. Saccharomyces cerevisiae YJM969 tRNA-Met
    134. Saccharomyces cerevisiae YJM972 tRNA-Met
    135. Saccharomyces cerevisiae YJM975 tRNA-Met
    136. Saccharomyces cerevisiae YJM978 tRNA-Met
    137. Saccharomyces cerevisiae YJM981 tRNA-Met
    138. Saccharomyces cerevisiae YJM984 tRNA-Met
    139. Saccharomyces cerevisiae YJM987 tRNA-Met
    140. Saccharomyces cerevisiae YJM990 tRNA-Met
    141. Saccharomyces cerevisiae YJM993 tRNA-Met
    142. Saccharomyces cerevisiae YJM996 tRNA-Met
    143. Saccharomyces cerevisiae YJSH1 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
    144. Saccharomyces eubayanus tRNA-Met
    145. Saccharomyces kudriavzevii IFO 1802 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
    146. Saccharomyces pastorianus tRNA-iMet
    147. Tetrapisispora phaffii CBS 4417 tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2)
    148. Vanderwaltozyma polyspora DSM 70294 tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 3)
    2D structure New