Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-593 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-593 precursor URS000052FD62_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-593: Hsa-mir-593 is a microRNA that has been studied in various contexts. In one study, it was found that the abundance of hsa-mir-593 increased more in induced pluripotent stem cells (iPSCs) and human embryonic stem cells (hESCs) compared to normal human dermal fibroblasts (NHDFs) [PMC4609408]. The study also observed a decrease in the abundance of hsa-miR-29a and hsa-miR-29b, and an increase in hsa-miR-182 in iPSCs and hESCs [PMC4609408]. In another study, it was reported that elevated levels of hsa-mir-593 were found in exosomes induced by rWNT5A, along with three other microRNAs [PMC4022450]. One of these microRNAs, hsa-mir-455, has been previously associated with various forms of cancer [PMC4022450]. Hsa-mir-593 has also been identified as a potential hub microRNA within a network associated with poor prognosis. The target genes of this network were implicated in the cell cycle [PMC8004706]. Hsa-mir-593 is located within an intron of SND1 (staphylococcal nuclease and tudor domain containing 1), which is a component of RISC (RNA-induced silencing complex) [PMC3675212]. Additionally, it was found that hsa-mir-593 comprises a miR-seed-SNP (single nucleotide polymorphism), specifically rs73721294. However, further validation is needed for this SNP [PMC3675212].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCCCAGAAUCUGUCAGGCACCAGCCAGGCAUUGCUCAGCCCGUUUCCCUCUGGGGGAGCAAGGAGUGGUGCUGGGUUUGUCUCUGCUGGGGUUUCUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications