Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila ananassae (Fruit fly) snRNA Dana\snRNA:U1:3 secondary structure diagram

Drosophila ananassae (Fruit fly) snRNA Dana\snRNA:U1:3 URS000052EC91_7217

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUACUUACCUGGCGUAGAGGUUAACCGUGAUCACGAAGGCGGUUCCUCCGGAGUGAGGCUUGGCCAUUGCACCUCGGCUGAGUUGACCUCUGCGAUUAUUCCUAAUGUGAAUAACUCGUGCGUGUAAUUUUUGGUAGCCGGGAAUGGCGUUCGCGCCGUCCCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Drosophila erecta (Fruit fly) snRNA Dere\snRNA:U1:4
  2. Drosophila melanogaster small nuclear RNA U1 at 95C a (Dmel_CR31341, Dmel_CR31656, Dmel_CR32866)
  3. Drosophila sechellia snRNA Dsec\snRNA:U1:2
  4. Drosophila simulans snRNA:U1:7
  5. Drosophila yakuba snRNA Dyak\snRNA:U1:10
2D structure