Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-183-5p URS0000528CBC_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-183: Rno-mir-183 is a microRNA that is downregulated in the spinal dorsal horn of rats with neuropathic pain [PMC8914318]. The downregulation of rno-mir-183 is associated with the upregulation of Hdac2 and activation of the TXNIP-NLRP3 inflammasome axis, which leads to an inflammatory response and worsens neuropathic pain [PMC8914318]. Hdac2 reduces the expression of rno-mir-183 by deacetylating histone H4 [PMC8914318]. In a study on thecal hyperandrogenesis, rno-mir-183 was found to be downregulated, suggesting its involvement in this condition [PMC3682887]. Rno-miR-24 and rno-mir-183 were highly expressed in the cystic follicles' theca cells, while rno-miR-31 and rno-miR-96 were present in cumulus granulosa cells [PMC3682887]. In rats treated with DHT, several miRNAs were found to be primarily downregulated, including rno-miR-21, rno-miR-31, and rno-mir-183 [PMC3682887]. Among fourteen miRNAs mapped to ingenuity databases, twelve had experimentally validated targets including rno-mir-183 [PMC3682887]. References: [PMC8914318] - Liang Y et al. (2020) The TXNIP-NLRP3 inflammasome axis mediates spinal dorsal horn pyroptosis in rats with neuropathic pain. J Neuroinflammation. 17(1): 43. [PMC3682887] - Yang Y et al. (2013) Differential expression profiles of microRNAs as potential biomarkers for thecal and granulosa cell tumors. Oncol Rep. 30(1): 311-7.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGGCACUGGUAGAAUUCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Alligator mississippiensis ami-miR-183-5p
  2. Bos taurus Bta-Mir-96-P3-v1_5p (mature (guide))
  3. Branchiostoma floridae (Florida lancelet) bfl-miR-183
  4. Callithrix jacchus cja-miR-183
  5. Callorhinchus milii Cmi-Mir-96-P3-v1_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-183
  7. Capra hircus (goat) chi-miR-183
  8. Cavia porcellus (domestic guinea pig) cpo-miR-183-5p
  9. Chiloscyllium plagiosum microRNA cpl-miR-183
  10. Chrysemys picta bellii Cpi-Mir-96-P3-v1_5p (mature (guide))
  11. Ciona intestinalis (vase tunicate) Cin-Mir-96-P3_5p (mature (guide))
  12. Columba livia Cli-Mir-96-P3-v1_5p (mature (guide))
  13. Danio rerio Dre-Mir-96-P3a-v1_5p (mature (guide))
  14. Dasypus novemcinctus dno-miR-183-5p
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-96-P3-v1_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-183
  17. Gadus morhua gmo-miR-183-5p
  18. Gallus gallus (chicken) Gga-Mir-96-P3-v1_5p (mature (guide))
  19. Homo sapiens (human) hsa-miR-183-5p
  20. Latimeria chalumnae Lch-Mir-96-P3_5p (mature (guide))
  21. Lepisosteus oculatus (spotted gar) Loc-Mir-96-P3-v1_5p (mature (guide))
  22. Macaca mulatta Mml-Mir-96-P3-v1_5p (mature (guide))
  23. Monodelphis domestica Mdo-Mir-96-P3-v1_5p (mature (guide))
  24. Monopterus albus Mal-Mir-96-P3b-v1_5p (mature (guide))
  25. Mus musculus (house mouse) mmu-miR-183-5p
  26. Ornithorhynchus anatinus oan-miR-183
  27. Oryctolagus cuniculus ocu-miR-183-5p
  28. Pongo pygmaeus (Bornean orangutan) ppy-miR-183
  29. Pteropus alecto pal-miR-183-5p
  30. Salmo salar (Atlantic salmon) ssa-miR-183-5p
  31. Sarcophilus harrisii Sha-Mir-96-P3-v1_5p (mature (guide))
  32. Scyliorhinus torazame (cloudy catshark) Sto-Mir-96-P3-v1_5p (mature (guide))
  33. Taeniopygia guttata tgu-miR-183
  34. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-96-P3b_5p (mature (guide))
  35. Tupaia chinensis tch-miR-183-5p
  36. Xenopus laevis (African clawed frog) Xla-Mir-96-P3c-v1_5p (mature (guide))
  37. Xenopus tropicalis Xtr-Mir-96-P3-v1_5p (mature (guide))
Publications