v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysemys picta (Painted turtle) cpi-miR-30c-2-3p URS0000527228_8479

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGGGAGAAGGCUGUUUACUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Anolis carolinensis aca-miR-30c-3p
  2. Cavia porcellus (domestic guinea pig) cpo-miR-30c-2-3p
  3. Cervus elaphus (red deer) Cel-miR-30c*
  4. Columba livia cli-miR-30c-2-3p
  5. Homo sapiens (human) hsa-miR-30c-2-3p
  6. Mus musculus (house mouse) mmu-miR-30c-2-3p
  7. Ophiophagus hannah oha-miR-30c-1-3p
  8. Ornithorhynchus anatinus oan-miR-30c-2-3p
  9. Oryctolagus cuniculus ocu-miR-30c-2-3p
  10. Python bivittatus (Burmese python) pbv-miR-30c-3p
  11. Rattus norvegicus (Norway rat) rno-miR-30c-2-3p
  12. Sus scrofa (pig) ssc-miR-30c-3p
  13. Taeniopygia guttata tgu-miR-30c-3p