Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM456 tRNA-Lys secondary structure diagram

Saccharomyces cerevisiae YJM456 tRNA-Lys URS0000524E7A_1294312

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGAAUAUUGUUUAAUGGUAAAACAGUUGUCUUUUAAGCAACCCAUGCUUGGUUCAACUCCAGCUAUUCUCAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 99 other species

  1. Saccharomyces cerevisiae tRNA-Lys
  2. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Lys
  3. Saccharomyces cerevisiae PE-2 tRNA-Lys
  4. Saccharomyces cerevisiae S288C tRNA-Lys
  5. Saccharomyces cerevisiae x Saccharomyces paradoxus tRNA-Lys
  6. Saccharomyces cerevisiae YJM1078 tRNA-Lys
  7. Saccharomyces cerevisiae YJM1083 tRNA-Lys
  8. Saccharomyces cerevisiae YJM1129 tRNA-Lys
  9. Saccharomyces cerevisiae YJM1133 tRNA-Lys
  10. Saccharomyces cerevisiae YJM1190 tRNA-Lys
  11. Saccharomyces cerevisiae YJM1199 tRNA-Lys
  12. Saccharomyces cerevisiae YJM1202 tRNA-Lys
  13. Saccharomyces cerevisiae YJM1208 tRNA-Lys
  14. Saccharomyces cerevisiae YJM1242 tRNA-Lys
  15. Saccharomyces cerevisiae YJM1244 tRNA-Lys
  16. Saccharomyces cerevisiae YJM1248 tRNA-Lys
  17. Saccharomyces cerevisiae YJM1250 tRNA-Lys
  18. Saccharomyces cerevisiae YJM1252 tRNA-Lys
  19. Saccharomyces cerevisiae YJM1273 tRNA-Lys
  20. Saccharomyces cerevisiae YJM1304 tRNA-Lys
  21. Saccharomyces cerevisiae YJM1307 tRNA-Lys
  22. Saccharomyces cerevisiae YJM1311 tRNA-Lys
  23. Saccharomyces cerevisiae YJM1326 tRNA-Lys
  24. Saccharomyces cerevisiae YJM1332 tRNA-Lys
  25. Saccharomyces cerevisiae YJM1336 tRNA-Lys
  26. Saccharomyces cerevisiae YJM1338 tRNA-Lys
  27. Saccharomyces cerevisiae YJM1341 tRNA-Lys
  28. Saccharomyces cerevisiae YJM1342 tRNA-Lys
  29. Saccharomyces cerevisiae YJM1355 tRNA-Lys
  30. Saccharomyces cerevisiae YJM1356 tRNA-Lys
  31. Saccharomyces cerevisiae YJM1381 tRNA-Lys
  32. Saccharomyces cerevisiae YJM1383 tRNA-Lys
  33. Saccharomyces cerevisiae YJM1385 tRNA-Lys
  34. Saccharomyces cerevisiae YJM1386 tRNA-Lys
  35. Saccharomyces cerevisiae YJM1387 tRNA-Lys
  36. Saccharomyces cerevisiae YJM1388 tRNA-Lys
  37. Saccharomyces cerevisiae YJM1389 tRNA-Lys
  38. Saccharomyces cerevisiae YJM1399 tRNA-Lys
  39. Saccharomyces cerevisiae YJM1400 tRNA-Lys
  40. Saccharomyces cerevisiae YJM1401 tRNA-Lys
  41. Saccharomyces cerevisiae YJM1402 tRNA-Lys
  42. Saccharomyces cerevisiae YJM1415 tRNA-Lys
  43. Saccharomyces cerevisiae YJM1417 tRNA-Lys
  44. Saccharomyces cerevisiae YJM1418 tRNA-Lys
  45. Saccharomyces cerevisiae YJM1419 tRNA-Lys
  46. Saccharomyces cerevisiae YJM1433 tRNA-Lys
  47. Saccharomyces cerevisiae YJM1434 tRNA-Lys
  48. Saccharomyces cerevisiae YJM1439 tRNA-Lys
  49. Saccharomyces cerevisiae YJM1443 tRNA-Lys
  50. Saccharomyces cerevisiae YJM1444 tRNA-Lys
  51. Saccharomyces cerevisiae YJM1447 tRNA-Lys
  52. Saccharomyces cerevisiae YJM1450 tRNA-Lys
  53. Saccharomyces cerevisiae YJM1460 tRNA-Lys
  54. Saccharomyces cerevisiae YJM1463 tRNA-Lys
  55. Saccharomyces cerevisiae YJM1477 tRNA-Lys
  56. Saccharomyces cerevisiae YJM1478 tRNA-Lys
  57. Saccharomyces cerevisiae YJM1479 tRNA-Lys
  58. Saccharomyces cerevisiae YJM1526 tRNA-Lys
  59. Saccharomyces cerevisiae YJM1527 tRNA-Lys
  60. Saccharomyces cerevisiae YJM1549 tRNA-Lys
  61. Saccharomyces cerevisiae YJM1573 tRNA-Lys
  62. Saccharomyces cerevisiae YJM1574 tRNA-Lys
  63. Saccharomyces cerevisiae YJM1592 tRNA-Lys
  64. Saccharomyces cerevisiae YJM1615 tRNA-Lys
  65. Saccharomyces cerevisiae YJM189 tRNA-Lys
  66. Saccharomyces cerevisiae YJM193 tRNA-Lys
  67. Saccharomyces cerevisiae YJM195 tRNA-Lys
  68. Saccharomyces cerevisiae YJM244 tRNA-Lys
  69. Saccharomyces cerevisiae YJM248 tRNA-Lys
  70. Saccharomyces cerevisiae YJM270 tRNA-Lys
  71. Saccharomyces cerevisiae YJM271 tRNA-Lys
  72. Saccharomyces cerevisiae YJM320 tRNA-Lys
  73. Saccharomyces cerevisiae YJM326 tRNA-Lys
  74. Saccharomyces cerevisiae YJM428 tRNA-Lys
  75. Saccharomyces cerevisiae YJM450 tRNA-Lys
  76. Saccharomyces cerevisiae YJM451 tRNA-Lys
  77. Saccharomyces cerevisiae YJM453 tRNA-Lys
  78. Saccharomyces cerevisiae YJM470 tRNA-Lys
  79. Saccharomyces cerevisiae YJM541 tRNA-Lys
  80. Saccharomyces cerevisiae YJM554 tRNA-Lys
  81. Saccharomyces cerevisiae YJM555 tRNA-Lys
  82. Saccharomyces cerevisiae YJM627 tRNA-Lys
  83. Saccharomyces cerevisiae YJM681 tRNA-Lys
  84. Saccharomyces cerevisiae YJM682 tRNA-Lys
  85. Saccharomyces cerevisiae YJM683 tRNA-Lys
  86. Saccharomyces cerevisiae YJM689 tRNA-Lys
  87. Saccharomyces cerevisiae YJM693 tRNA-Lys
  88. Saccharomyces cerevisiae YJM969 tRNA-Lys
  89. Saccharomyces cerevisiae YJM972 tRNA-Lys
  90. Saccharomyces cerevisiae YJM975 tRNA-Lys
  91. Saccharomyces cerevisiae YJM978 tRNA-Lys
  92. Saccharomyces cerevisiae YJM981 tRNA-Lys
  93. Saccharomyces cerevisiae YJM984 tRNA-Lys
  94. Saccharomyces cerevisiae YJM987 tRNA-Lys
  95. Saccharomyces cerevisiae YJM990 tRNA-Lys
  96. Saccharomyces cerevisiae YJM993 tRNA-Lys
  97. Saccharomyces cerevisiae YJM996 tRNA-Lys
  98. Saccharomyces mikatae tRNA-Lys
  99. Saccharomyces paradoxus tRNA-Lys
2D structure