v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) promoter of CDKN1A antisense DNA damage activated RNA (PANDAR) URS0000524E5C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PANDAR: PANDAR inhibits miR-637 expression by directly targeting its 3'UTR and reverses the growth inhibition of thyroid gland carcinoma cells caused by KLK4 downregulation [PMC8408101]. PANDAR and LncRNA-UCA1 increase expression of urinary bladder cancer [PMC9041284]. PANDAR is specifically upregulated by doxorubicin-induced DNA damage and depletion of PANDAR sensitizes fibroblasts to DNA-damage-induced apoptosis [PMC5268331]. PANDAR is a powerful diagnostic and therapeutic marker for patients with gastric cancer [PMC7775490]. PANDAR is involved in the regulation of the CDKN1A locus and interacts with p53 binding sites [PMC5065170]. PANDAR binds to SFRS2, which influences cisplatin sensitivity [PMC6207559]. PANDAR promotes cell proliferation in bladder cancer and impacts the promoter activity of p16INK4A, leading to suppressed cell growth [PMC4873988][PMC4772134]. High expression levels of PANDAR are associated with lower CR rate and shortened survival in AML patients [PMC9695865]. PTBP1 overexpression rescues the reduction of BCL-XS mRNA induced by PANDAR overexpression [PMC5809411]. LncRNA PANDAR is highly expressed in lung cancer, colorectal cancer, renal cell carcinoma, etc. [PMC8806334]. Overexpression of PANDAR suppresses cell apoptosis in bladder cancer cells [PMC4873988]. High expression levels of PANDAR are associated with lower CR rate in AML patients and predict overall survival in ccRCC patients[ PMC6214337][ PMC10034124].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACGAAUUCUUUCAGGAAUGCCGCAGAUGUACAUGCUCCCGCAGAUCUAUAUUUUCCAAUGUUGUUAACAUCAGCCAGCUGGCAAUCUACAACCUGUCUUGUACAAUGUUUGAAGAGAGGCAUCCUCCAGACACGGUCCCCUGUUUCAAUGCUGGCCUCGAAGAGCUUGUUCCAGAGCCAGGAUGAAUUGGUAAAGACCCCAGUGGCACCUGACCCCAAAGCUACAUCUAUGACACCUGUUAAGGUGGUGGCAUUGAGGAUGACCUUCGGGUUAAAUGUGUGCACGUAACAGAGCGCAUCAGCCAGUAUGAGCCUCCCCUCAGCAUCAGUGUUACCAACCUGGAUGGUCUUCCUGUUCCUGGCUCUAACAACAUCCCCCAGCUUGUUGGCCUUGCCGCUGGGCAUGUUUUCACAGAGGGGCCAGACCUAUAAUAUUAAUGGGCAAACUGAGAUUUGCAGCAGACACAAUGGCUGAGCAUAUAGUUGUAGCUCCUCCCAUGUCGGCCCUCAUGAGGUCCAUAUUUGCAGAAGCCUUGAUGGAGAUACCACCACUGUCAAAGGUAAUUCCUUUCCCAACAAACAAGGGGUGGUUUGUCUGCAUUGGGGCUGCCUAUGUAGUGAAUUUCCAAGAAGACUGAGGGCUCGUCAGAUCCUUUGGCCACACUGAGGAAUGAUCCCAUUGCCUGUUCCUCAAUCCAAGACCUGGGUCUGAUAUGAAACUCGGUUUACUACUAGCGCUUUUGAGAUUCUUCUCAAUAAUUUCGGCAAAUCUGGUUGGCAUCAUCUCGCUGGCUGGCGUCUCCAUCAUGCCAAGUUCUGCCCAGAAGCAAACAGGACUCCUUUCUGCCAGGCCUCCUGAUCCCCAGUUCCAUAGAGCUUCACCGACAUAGCCAUCUUCUUUUUUUGCUUUAGGUCAUCGUAUUCAUAGAGACCAAGCACCGCGCCCUCCUCAGCAGCCUGAGCAUCUCUACAGGGAUCCACCUCCACGGAAGAGAGCUCCAGGUCUUGAAUCUGCCUGCAUCCUGCUGCAACAGCAGCUCUGAUGUUUUCUUUGCCUUCCUGCCAGUUUUCCUGUUCGUCGAUUCUGGCUGCCUUUUUGCCGAGGCCAACUAGCACCACGCUGGGGAAGUCCUGAUGCAGACCAUAAAAGUUUCGAGUCUUGCCUGCCUUCAGAGGUGGUCCAGAUAUGUUCAAAGUCUCUCUCAGCUUUCCAGCUAUCAAUUUAUCAAGAUUCUCUCCUGCACUUGUGAACUGUGGCACAUCAUCUUCUUUUUCUUUGGAAUAGAUUCCUAAAACAAGGCCCUUCGUCAUGUCUGCAGCGGAGAGACCCCGGCUCCCGAAACAUCUCACGGCCAGACGUCAGACGAUGACUCGCCCCACCCAAUGUUUGUAUUUUAGUAGAGAGAGGGUUUCUCUAUGUUGGUCAGGCUGGUCUCAAACCUCGACCUCAGUUGAUCUGUCUGCCUCGGUCUCCCAAAGUGCUGAGAUUACAGGCGUGAGCCACUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications