Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis briggsae cbr-miR-2 URS000051D980_6238

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUCACAGCCAGCUUUGAUGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Ascaris suum (pig roundworm) asu-miR-2a-3p
  2. Caenorhabditis brenneri cbn-miR-2
  3. Caenorhabditis elegans cel-miR-2-3p
  4. Caenorhabditis remanei crm-miR-2-3p
  5. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-1220290
  6. Haemonchus contortus hco-miR-2
  7. Nasonia vitripennis nvi-miR-2b