Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR1846e
URS0000510FB1_39947
Genome locations
Gene Ontology annotations
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset
CAACGAGGAGGCCGGGACCA
Taxonomic tree
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree.
Click tree nodes to collapse or expand them.
Hover over taxon names to display additional information.
This sequence is found in 1 other species
Download