Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Heliconius melpomene (postman butterfly) hme-miR-283 URS000050EA3B_34740

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAAUAUCAGCUGGUAAUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-283
  2. Bombyx mori (domestic silkworm) bmo-miR-283-5p
  3. Drosophila ananassae dan-miR-283
  4. Drosophila erecta der-miR-283
  5. Drosophila grimshawi dgr-miR-283
  6. Drosophila mojavensis dmo-miR-283
  7. Drosophila persimilis dpe-miR-283
  8. Drosophila pseudoobscura dps-miR-283
  9. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294489_df_nrg
  10. Drosophila sechellia dse-miR-283
  11. Drosophila simulans dsi-miR-283
  12. Drosophila willistoni dwi-miR-283
  13. Drosophila yakuba dya-miR-283