Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ananas comosus (pineapple) microRNA 156d URS0000509E19_4615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACAGAAGAGAGAGAGCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Brachypodium distachyon bdi-miR156a
  2. Cynara cardunculus var. scolymus cca-miR156j
  3. Glycine max (soybean) gma-miR156b
  4. Lolium arundinaceum far-miR156a
  5. Medicago truncatula (barrel medic) mtr-miR156a
  6. Oryza sativa Japonica Group microRNA osa-miR156k
  7. Oryza sativa osa-miR156k
  8. Ricinus communis (castor bean) rco-miR156e
  9. Sorghum bicolor sbi-miR156d
  10. Theobroma cacao (cacao) tcc-miR156a
  11. Zea mays zma-miR156j-5p