Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS0000507CED_559292

Automated summary: This snoRNA sequence is 87 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (ENA, SGD, IntAct, RefSeq). Described in 35 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR78, RF01176). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR78 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 4

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11711562 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-11794843 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-16640603 P38996 D6W3H8 EBI-11776 HMD1 NAB3 P38996 Q07034 YPL190C nab3_yeast
EBI-16640633 P53617 D6W0U2 EBI-12228 N0868 NRD1 P53617 YNL251C nrd1_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCCUUGAUGACCAAAAUAAAUUUUUACAAACUAGAGUUUCUGAAUCUUUUGUGAUUAGAACGUUUAUUCUUAUUUCUGAGGUUUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 98 other species

    1. Saccharomyces cerevisiae small nucleolar RNA snR78
    2. Saccharomyces cerevisiae EC1118 SNR78
    3. Saccharomyces cerevisiae PE-2 SNR78
    4. Saccharomyces cerevisiae R008 SNR78
    5. Saccharomyces cerevisiae R103 SNR78
    6. Saccharomyces cerevisiae YJM1078 SNR78
    7. Saccharomyces cerevisiae YJM1083 SNR78
    8. Saccharomyces cerevisiae YJM1129 SNR78
    9. Saccharomyces cerevisiae YJM1133 SNR78
    10. Saccharomyces cerevisiae YJM1190 SNR78
    11. Saccharomyces cerevisiae YJM1199 SNR78
    12. Saccharomyces cerevisiae YJM1202 SNR78
    13. Saccharomyces cerevisiae YJM1208 SNR78
    14. Saccharomyces cerevisiae YJM1242 SNR78
    15. Saccharomyces cerevisiae YJM1244 SNR78
    16. Saccharomyces cerevisiae YJM1248 SNR78
    17. Saccharomyces cerevisiae YJM1250 SNR78
    18. Saccharomyces cerevisiae YJM1252 SNR78
    19. Saccharomyces cerevisiae YJM1273 SNR78
    20. Saccharomyces cerevisiae YJM1304 SNR78
    21. Saccharomyces cerevisiae YJM1307 SNR78
    22. Saccharomyces cerevisiae YJM1311 SNR78
    23. Saccharomyces cerevisiae YJM1326 SNR78
    24. Saccharomyces cerevisiae YJM1332 SNR78
    25. Saccharomyces cerevisiae YJM1336 SNR78
    26. Saccharomyces cerevisiae YJM1338 SNR78
    27. Saccharomyces cerevisiae YJM1341 SNR78
    28. Saccharomyces cerevisiae YJM1342 SNR78
    29. Saccharomyces cerevisiae YJM1355 SNR78
    30. Saccharomyces cerevisiae YJM1356 SNR78
    31. Saccharomyces cerevisiae YJM1381 SNR78
    32. Saccharomyces cerevisiae YJM1383 SNR78
    33. Saccharomyces cerevisiae YJM1385 SNR78
    34. Saccharomyces cerevisiae YJM1386 SNR78
    35. Saccharomyces cerevisiae YJM1387 SNR78
    36. Saccharomyces cerevisiae YJM1388 SNR78
    37. Saccharomyces cerevisiae YJM1389 SNR78
    38. Saccharomyces cerevisiae YJM1399 SNR78
    39. Saccharomyces cerevisiae YJM1400 SNR78
    40. Saccharomyces cerevisiae YJM1401 SNR78
    41. Saccharomyces cerevisiae YJM1402 SNR78
    42. Saccharomyces cerevisiae YJM1415 SNR78
    43. Saccharomyces cerevisiae YJM1417 SNR78
    44. Saccharomyces cerevisiae YJM1418 SNR78
    45. Saccharomyces cerevisiae YJM1419 SNR78
    46. Saccharomyces cerevisiae YJM1433 SNR78
    47. Saccharomyces cerevisiae YJM1434 SNR78
    48. Saccharomyces cerevisiae YJM1439 SNR78
    49. Saccharomyces cerevisiae YJM1443 SNR78
    50. Saccharomyces cerevisiae YJM1444 SNR78
    51. Saccharomyces cerevisiae YJM1447 SNR78
    52. Saccharomyces cerevisiae YJM1450 SNR78
    53. Saccharomyces cerevisiae YJM1460 SNR78
    54. Saccharomyces cerevisiae YJM1463 SNR78
    55. Saccharomyces cerevisiae YJM1477 SNR78
    56. Saccharomyces cerevisiae YJM1478 SNR78
    57. Saccharomyces cerevisiae YJM1479 SNR78
    58. Saccharomyces cerevisiae YJM1526 SNR78
    59. Saccharomyces cerevisiae YJM1527 SNR78
    60. Saccharomyces cerevisiae YJM1549 SNR78
    61. Saccharomyces cerevisiae YJM1573 SNR78
    62. Saccharomyces cerevisiae YJM1574 SNR78
    63. Saccharomyces cerevisiae YJM1592 SNR78
    64. Saccharomyces cerevisiae YJM1615 SNR78
    65. Saccharomyces cerevisiae YJM189 SNR78
    66. Saccharomyces cerevisiae YJM193 SNR78
    67. Saccharomyces cerevisiae YJM195 SNR78
    68. Saccharomyces cerevisiae YJM244 SNR78
    69. Saccharomyces cerevisiae YJM248 SNR78
    70. Saccharomyces cerevisiae YJM270 SNR78
    71. Saccharomyces cerevisiae YJM271 SNR78
    72. Saccharomyces cerevisiae YJM320 SNR78
    73. Saccharomyces cerevisiae YJM326 SNR78
    74. Saccharomyces cerevisiae YJM428 SNR78
    75. Saccharomyces cerevisiae YJM450 SNR78
    76. Saccharomyces cerevisiae YJM451 SNR78
    77. Saccharomyces cerevisiae YJM453 SNR78
    78. Saccharomyces cerevisiae YJM456 SNR78
    79. Saccharomyces cerevisiae YJM470 SNR78
    80. Saccharomyces cerevisiae YJM541 SNR78
    81. Saccharomyces cerevisiae YJM554 SNR78
    82. Saccharomyces cerevisiae YJM555 SNR78
    83. Saccharomyces cerevisiae YJM627 SNR78
    84. Saccharomyces cerevisiae YJM681 SNR78
    85. Saccharomyces cerevisiae YJM682 SNR78
    86. Saccharomyces cerevisiae YJM683 SNR78
    87. Saccharomyces cerevisiae YJM689 SNR78
    88. Saccharomyces cerevisiae YJM693 SNR78
    89. Saccharomyces cerevisiae YJM969 SNR78
    90. Saccharomyces cerevisiae YJM972 SNR78
    91. Saccharomyces cerevisiae YJM975 SNR78
    92. Saccharomyces cerevisiae YJM978 SNR78
    93. Saccharomyces cerevisiae YJM981 SNR78
    94. Saccharomyces cerevisiae YJM984 SNR78
    95. Saccharomyces cerevisiae YJM987 SNR78
    96. Saccharomyces cerevisiae YJM990 SNR78
    97. Saccharomyces cerevisiae YJM993 SNR78
    98. Saccharomyces cerevisiae YJM996 SNR78
    2D structure New