Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anopheles gambiae str. PEST tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12) secondary structure diagram

Anopheles gambiae str. PEST tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12) URS0000505894_180454

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCAUAUUGUCUAGUGGUUAGGAUAUCCGGCUCUCACCCGGAAGGCCCGGGUUCGAUUCCCGGUAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 61 other species

  1. Aedes aegypti tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 20)
  2. Aedes albopictus (Asian tiger mosquito) tRNA tRNA-Glu
  3. Anastrepha ludens (Mexican fruit fly) transfer RNA glutamic acid (anticodon CUC)
  4. Anastrepha obliqua (WestIndian fruit fly) transfer RNA glutamic acid (anticodon CUC)
  5. Anopheles albimanus (Mosquitos) tRNA-Glu
  6. Anopheles arabiensis (Mosquito) tRNA tRNA-Glu
  7. Anopheles atroparvus tRNA
  8. Anopheles christyi (Mosquito) tRNA tRNA-Glu
  9. Anopheles coluzzii (Mosquito) tRNA-Glu for anticodon CUC
  10. Anopheles culicifacies tRNA tRNA-Glu
  11. Anopheles darlingi tRNA ADAC010765
  12. Anopheles dirus tRNA
  13. Anopheles epiroticus tRNA tRNA-Glu
  14. Anopheles farauti tRNA tRNA-Glu
  15. Anopheles funestus tRNA-Glu for anticodon CUC
  16. Anopheles gambiae tRNA tRNA-Glu
  17. Anopheles maculatus (Mosquito) tRNA tRNA-Glu
  18. Anopheles melas (Mosquito) tRNA tRNA-Glu
  19. Anopheles merus (Mosquito) tRNA tRNA-Glu
  20. Anopheles minimus (Mosquito) tRNA tRNA-Glu
  21. Anopheles quadriannulatus (Mosquito) tRNA tRNA-Glu
  22. Anopheles sinensis (Mosquito) tRNA tRNA-Glu
  23. Anopheles stephensi tRNA tRNA-Glu
  24. Bactrocera dorsalis (Oriental fruit fly) transfer RNA glutamic acid (anticodon CUC)
  25. Bactrocera latifrons (Solanum fruit fly) tRNA-Glu
  26. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA glutamic acid (anticodon CUC)
  27. Bactrocera oleae (Olive fruit fly) tRNA-Glu
  28. Bactrocera tryoni (Queensland fruitfly) tRNA-Glu
  29. Ceratitis capitata (Mediterranean fruit fly) tRNA-Glu
  30. Culex pipiens pallens (Northern house mosquito) transfer RNA glutamic acid (anticodon CUC)
  31. Culex quinquefasciatus tRNA
  32. Culicoides brevitarsis (Biting midge) transfer RNA glutamic acid (anticodon CUC)
  33. Drosophila ananassae tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 6)
  34. Drosophila biarmipes (Fruit fly) transfer RNA glutamic acid (anticodon CUC)
  35. Drosophila bipectinata (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  36. Drosophila erecta tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
  37. Drosophila eugracilis (Fruit fly) tRNA-Glu
  38. Drosophila ficusphila (Fruit fly) tRNA-Glu
  39. Drosophila innubila (Fruit fly) tRNA-Glu
  40. Drosophila kikkawai (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  41. Drosophila mauritiana (Fruit fly) tRNA-Glu
  42. Drosophila melanogaster (fruit fly) transfer RNA:Glutamic acid-CTC 1-1 (Dmel_CR30239)
  43. Drosophila montana (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  44. Drosophila novamexicana (Pomace flies) tRNA-Glu
  45. Drosophila santomea (Fruit fly) tRNA-Glu
  46. Drosophila sechellia tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1)
  47. Drosophila serrata (Pomace flies) tRNA-Glu
  48. Drosophila simulans tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
  49. Drosophila subpulchrella (Fruit fly) tRNA-Glu
  50. Drosophila suzukii (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  51. Drosophila takahashii (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  52. Drosophila teissieri (Fruit fly) tRNA-Glu
  53. Drosophila tropicalis (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  54. Drosophila virilis tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
  55. Drosophila willistoni tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 5)
  56. Drosophila yakuba tRNA-Glu (CTC) (tRNA-Glu-CTC-1-1)
  57. Malaya genurostris (Mosquitos) transfer RNA glutamic acid (anticodon CUC)
  58. Rhagoletis pomonella tRNA-Glu
  59. Scaptodrosophila lebanonensis tRNA
  60. Topomyia yanbarensis (Mosquitos) transfer RNA glutamic acid (anticodon CUC)
  61. Toxorhynchites rutilus septentrionalis (Elephant mosquito) transfer RNA glutamic acid (anticodon CUC)
  62. Uranotaenia lowii (Mosquitos) transfer RNA glutamic acid (anticodon CUC)
  63. Wyeomyia smithii (Pitcher plant Mosquito) transfer RNA glutamic acid (anticodon CUC)
  64. Zeugodacus cucurbitae (Melon fly) transfer RNA glutamic acid (anticodon CUC)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications