v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae (baker's yeast) RNA of unknown function 20 secondary structure diagram

Saccharomyces cerevisiae (baker's yeast) RNA of unknown function 20 URS0000505673_4932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACGUGGGUUUUUUUUUCGAAUUGAGUGAUUAUGCAACCAUACAGGAACCUUACAUAAGCGCAAGUAGUUGAAUAGUGGAUUCAAGAAGCAAAACUUUACUACCGGUAAAAACAUUAGAACGAAAUAAAAGUGCUGAAUCUUAAAAGUAAAAUAUAUACUUGGAUAAGAAUUCCCAGGGAAACUGGGAACCUCGUUUUCCUGUUGCACUAUUUUUUAGAUUCUUUCUUGAUUUUUUACCAAUCGCCUGAUGAAAAUACCUUCCAGAGCAGAGAACAACAGUAGAAGUAUGCUGAAAAAGUUAGUGUGAGAAGUUUGAAUUGUUUAGAUAAUAUAAAAGUGACAUCUAAUAUGACUAAUAUAAAAAUAGUAAGUAUGGUAAUCAAAAAAAGAUACAAACAAUGUAUAUAUAUAAAGGAAAAAUAACCUGCGAAUAUUGAGAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Saccharomyces cerevisiae S288C RNA of Unknown Function
 2D structure Publications