Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila willistoni dwi-miR-263b URS00004FD7F0_7260

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUGGCACUGGGAGAAUUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Anopheles gambiae aga-miR-263b
  2. Bombyx mori (domestic silkworm) bmo-miR-263b-5p
  3. Cochliomyia hominivorax (primary screw-worm) mature cho-miR-263b
  4. Cochliomyia macellaria (secondary screw-worm) mature cma-miR-263b
  5. Drosophila ananassae dan-miR-263b
  6. Drosophila erecta der-miR-263b
  7. Drosophila grimshawi dgr-miR-263b
  8. Drosophila melanogaster (fruit fly) dme-miR-263b-5p
  9. Drosophila persimilis dpe-miR-263b
  10. Drosophila pseudoobscura dps-miR-263b
  11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294503_df_nrg
  12. Drosophila sechellia dse-miR-263b
  13. Drosophila simulans dsi-miR-263b
  14. Drosophila yakuba dya-miR-263b