Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 51 (SNORA51) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 51 (SNORA51) URS00004F2BDE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA51: SNORA51 is a small nucleolar RNA (snoRNA) belonging to the H/ACA family [PMC9454646]. It is part of the NOL5A snoRNA family, which also includes SNORD56, SNORD57, SNORD86, and SNORD110 [PMC4159348]. The presence of mature snoRNAs from the same locus as SNORA51 suggests that they may be processed into small RNA fragments called sdRNAs [PMC4159348]. SNORA51 is a human-specific snoRNA and is the only member of its family [PMC4824147]. It is encoded within the NOP56 gene locus on chromosome 20p13 and shares this locus with other snoRNAs such as SNORD56, SNORD57, and SNORD110 [PMC9454646]. TGIRT-seq data supports the presence of full-length SNORD57 and small RNA fragments derived from its 3' end in human plasma, indicating that other snoRNAs encoded within NOP56 gene locus, such as SNORA51, may also be present in plasma [PMC7962485]. The gene mainly associated with SNORA51 is NOP56 [PMC6524185]. A conserved interaction between SNORA51 and 28S-1849 has been predicted [PMC4914119]. In idiopathic membranous nephropathy, upregulation of blood and urinary levels of various snoRNAs including SNORA51 has been reported [PMC7441435].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCUCCUGGUGCUUACCACAGGCUGUGUUCUUACACUGACUGUAUAGAAAGAGGAGGUAGAGUAAACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications