v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rno-Mir-23-P2_3p (mature (guide)) URS00004E57E7_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUCACAUUGCCAGGGAUUACCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-23b-3p
  2. Anolis carolinensis (green anole) Aca-Mir-23-P2_3p (mature (guide))
  3. Bos taurus (cattle) bta-miR-23b-3p
  4. Callorhinchus milii Cmi-Mir-23-P2_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-23-P2_3p (mature (guide))
  6. Cavia porcellus cpo-miR-23b-3p
  7. Chrysemys picta bellii Cpi-Mir-23-P2_3p (mature (guide))
  8. Columba livia Cli-Mir-23-P2_3p (mature (guide))
  9. Danio rerio (zebrafish) dre-miR-23b-3p
  10. Dasypus novemcinctus dno-miR-23b-3p
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-23-P2_3p (mature (guide))
  12. Eptatretus burgeri (inshore hagfish) Ebu-Mir-23-P5_3p (mature (guide))
  13. Gallus gallus (chicken) Gga-Mir-23-P2_3p (mature (guide))
  14. Gekko japonicus Gja-Mir-23-P2_3p (mature (guide))
  15. Homo sapiens (human) hsa-miR-23b-3p
  16. Latimeria chalumnae Lch-Mir-23-P2_3p (mature (guide))
  17. Lepisosteus oculatus Loc-Mir-23-P2_3p (mature (guide))
  18. Macaca mulatta Mml-Mir-23-P2_3p (mature (guide))
  19. Microcaecilia unicolor Mun-Mir-23-P2_3p (mature (guide))
  20. Monodelphis domestica Mdo-Mir-23-P2_3p (mature (guide))
  21. Mus musculus Mmu-Mir-23-P2_3p (mature (guide))
  22. Ophiophagus hannah oha-miR-23b-3p
  23. Oryctolagus cuniculus (rabbit) ocu-miR-23b-3p
  24. Oryzias latipes ola-miR-23b
  25. Pan paniscus (pygmy chimpanzee) ppa-miR-23b
  26. Pan troglodytes (chimpanzee) ptr-miR-23b
  27. Petromyzon marinus (sea lamprey) pma-miR-23b
  28. Pongo pygmaeus (Bornean orangutan) ppy-miR-23b
  29. Python bivittatus pbv-miR-23b-3p
  30. Scyliorhinus torazame (cloudy catshark) Sto-Mir-23-P2_3p (mature (guide))
  31. Sphenodon punctatus (tuatara) Spt-Mir-23-P2_3p (mature (guide))
  32. Taeniopygia guttata (zebra finch) Tgu-Mir-23-P2_3p (mature (guide))
  33. Xenopus laevis (African clawed frog) Xla-Mir-23-P2c_3p (mature (guide))
  34. Xenopus tropicalis Xtr-Mir-23-P2_3p (mature (guide))