Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-129a-5p URS00004E1410_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-129b: Ssc-mir-129b is a microRNA that has been studied in various contexts [PMC8834144]. It has been used in qRT-PCR verification alongside other genes and miRNAs [PMC8834144]. Ssc-mir-129b has also been identified as one of the most affected RNAs in a network analysis [PMC8861501]. In studies involving ZEN exposure, ssc-mir-129b was found to be down-regulated [PMC6598998][PMC6722729]. However, it has been suggested that ssc-mir-129b may have little impact on immunity or inflammation in porcine PBMCs [PMC7903524]. Differential expression of ssc-mir-129b has also been validated by quantitative PCR, showing up-regulation by LPS stimulation [PMC7903524]. Ssc-mir-129b is poorly expressed in porcine PBMCs compared to other miRNAs such as ssc-miR-122 and ssc-miR-17-5p [PMC7903524]. Further studies are needed to understand the potential functions of ssc-mir-129b and its target genes in the inflammatory process [PMC7903524]. In addition to its role in inflammation, miR-17-5p, which is modestly expressed compared to ssc-miR122 and ssc-miR17.5p, has been shown to inhibit IL1β and TNFα expressions by targeting TLR4 [PMC7903524][44].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUUUGCGGUCUGGGCUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis ami-miR-129b-5p
  2. Anolis carolinensis (green anole) aca-miR-129a-5p
  3. Bos taurus (cattle) Bta-Mir-129-P1_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-129
  5. Callorhinchus milii (elephant shark) Cmi-Mir-129-P2_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-129
  7. Capra hircus (goat) chi-miR-129-5p
  8. Cavia porcellus cpo-miR-129-5p
  9. Cervus elaphus cel-miR-129
  10. Chiloscyllium plagiosum microRNA cpl-miR-129
  11. Chrysemys picta bellii Cpi-Mir-129-P1_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-129-5p
  13. Columba livia cli-miR-129-5p
  14. Cricetulus griseus (Chinese hamster) cgr-miR-129
  15. Cyprinus carpio ccr-miR-129
  16. Danio rerio Dre-Mir-129-P1b_5p (mature (guide))
  17. Dasypus novemcinctus dno-miR-129-5p
  18. Echinops telfairi Ete-Mir-129-P1_5p (mature (co-guide))
  19. Equus caballus (horse) eca-miR-129a-5p
  20. Gadus morhua (Atlantic cod) gmo-miR-129-3-5p
  21. Gallus gallus (chicken) gga-miR-129-5p
  22. Gekko japonicus Gja-Mir-129-P1_5p (mature (co-guide))
  23. Haplochromis burtoni abu-miR-129
  24. Homo sapiens hsa-miR-129-5p
  25. Ictalurus punctatus ipu-miR-129
  26. Latimeria chalumnae (coelacanth) Lch-Mir-129-P1_5p (mature (guide))
  27. Lepisosteus oculatus Loc-Mir-129-P1_5p (mature (co-guide))
  28. Macaca mulatta (Rhesus monkey) mml-miR-129-5p
  29. Maylandia zebra (zebra mbuna) mze-miR-129
  30. Microcaecilia unicolor Mun-Mir-129-P2_5p (mature (guide))
  31. Monodelphis domestica Mdo-Mir-129-P2_5p (mature (guide))
  32. Monopterus albus Mal-Mir-129-P1b_5p (mature (guide))
  33. Mus musculus (house mouse) mmu-miR-129-5p
  34. Neolamprologus brichardi (lyretail cichlid) nbr-miR-129
  35. Oreochromis niloticus oni-miR-129
  36. Ornithorhynchus anatinus oan-miR-129-5p
  37. Oryctolagus cuniculus ocu-miR-129-5p
  38. Pan troglodytes ptr-miR-129
  39. Pongo pygmaeus (Bornean orangutan) ppy-miR-129-5p
  40. Pteropus alecto pal-miR-129b-5p
  41. Pundamilia nyererei pny-miR-129
  42. Python bivittatus (Burmese python) pbv-miR-129a-5p
  43. Rattus norvegicus rno-miR-129-5p
  44. Salmo salar (Atlantic salmon) ssa-miR-129-5p
  45. Sarcophilus harrisii sha-miR-129
  46. Scyliorhinus torazame Sto-Mir-129-P2_5p (mature (guide))
  47. Sphenodon punctatus (tuatara) Spt-Mir-129-P1_5p (mature (guide))
  48. Taeniopygia guttata (zebra finch) tgu-miR-129-5p
  49. Tetraodon nigroviridis Tni-Mir-129-P2b_5p (mature (guide))
  50. Tupaia chinensis tch-miR-129-5p
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-129
Publications