Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aquilegia coerulea (Rocky Mountain columbine) aqc-miR172a URS00004D8ACB_218851

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAUCUUGAUGAUGCUGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Aegilops tauschii ata-miR172b-3p
  2. Ananas comosus miR172
  3. Arabidopsis lyrata (lyrate rockcress) aly-miR172a-3p
  4. Arabidopsis thaliana (thale cress) ath-miR172b-3p
  5. Asparagus officinalis aof-miR172
  6. Brachypodium distachyon (stiff brome) bdi-miR172a-3p
  7. Brassica napus bna-miR172a
  8. Brassica oleracea bol-miR172b
  9. Brassica rapa bra-miR172a
  10. Camelina sativa (false flax) cas-miR172a-3p
  11. Citrus sinensis (sweet orange) csi-miR172b-3p
  12. Cucumis melo (muskmelon) cme-miR172b
  13. Cynara cardunculus (wild artichoke) cca-miR172
  14. Digitalis purpurea (common foxglove) dpr-miR172b
  15. Elaeis guineensis egu-miR172c
  16. Eugenia uniflora (Brazil-cherry) eun-miR172c-3p
  17. Fragaria vesca subsp. vesca fve-miR172c
  18. Glycine max (soybean) gma-miR172h-3p
  19. Helianthus annuus (common sunflower) ath-miR172a
  20. Linum usitatissimum (flax) lus-miR172a
  21. Malus domestica (apple) mdm-miR172h
  22. Manihot esculenta mes-miR172b
  23. Medicago truncatula mtr-miR172b
  24. Nicotiana tabacum nta-miR172e
  25. Oryza sativa (Asian cultivated rice) osa-miR172a
  26. Oryza sativa Japonica Group microRNA osa-miR172d-3p
  27. Populus tomentosa Pto-miR172c
  28. Populus trichocarpa (black cottonwood) ptc-miR172c
  29. Prunus persica (peach) ppe-miR172b
  30. Salvia sclarea (clary) ssl-miR172
  31. Solanum lycopersicum sly-miR172a
  32. Solanum tuberosum stu-miR172b-3p
  33. Theobroma cacao (cacao) tcc-miR172e
  34. Vigna unguiculata (cowpea) vun-miR172
  35. Vriesea carinata vca-miR172b-3p