Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-615 URS00004D8280_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-615: Bta-mir-615 is one of the 13 highly abundant miRNAs identified in the study, with Ct numbers between 10-25 Ct [PMC5472319]. The study aimed to evaluate the molecular effects of different culture systems on post-transcriptional regulators, and bta-mir-615 was investigated as a biomarker for embryo quality and development [PMC10121032]. The expression of bta-mir-615 was found to be decreased in the LM group compared to the control group [PMC10121032]. The RT-qPCR method was used to measure bta-mir-615 expression, with specific primers and reagents [PMC10121032]. Additionally, bta-mir-615 was found to be one of the top four miRNAs enriched in extracellular vesicles from both fluids [PMC9594899]. Furthermore, bta-mir-615 is a tissue-specific miRNA that is expressed in rumen tissue [PMC6371894]. Overall, these findings suggest that bta-mir-615 may play a role in embryo development and quality assessment, as well as being involved in intercellular communication through extracellular vesicles. Further research is needed to fully understand its specific functions and mechanisms.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGGUCCCCGGUGCUCGGAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Cavia porcellus cpo-miR-615-5p
  2. Cricetulus griseus cgr-miR-615-5p
  3. Equus caballus (horse) eca-miR-615-5p
  4. Homo sapiens (human) hsa-miR-615-5p
  5. Macaca mulatta mml-miR-615-5p
  6. Mus musculus (house mouse) mmu-miR-615-5p
  7. Rattus norvegicus rno-miR-615
Publications