v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Linum usitatissimum (flax) lus-miR159c URS00004D2E37_4006

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUUGGAUUGAAGGGAGCUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Ananas comosus (pineapple) microRNA 159b
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR159b-3p
  3. Arabidopsis thaliana (thale cress) ath-miR159b-3p
  4. Camelina sativa (false flax) cas-miR159c-3p
  5. Cynara cardunculus var. scolymus cca-miR159b
  6. Nicotiana attenuata microRNA mir-159-like
  7. Pachycladon cheesemanii Pch-miR159b
  8. Pachycladon fastigiatum Pfa-miR159b
 Publications