Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) Oan-Mir-129-P2_3p* (star (passenger)) URS00004CCDA3_9258

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCCCUUACCCCAAAAAGUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Alligator mississippiensis ami-miR-129a-3p
  2. Anolis carolinensis (green anole) Aca-Mir-129-P2_3p* (star (passenger))
  3. Bos taurus (domestic cattle) Bta-Mir-129-P2_3p* (star (passenger))
  4. Callorhinchus milii (elephant shark) Cmi-Mir-129-P2_3p* (star (passenger))
  5. Canis lupus familiaris Cfa-Mir-129-P2_3p* (star (passenger))
  6. Cavia porcellus cpo-miR-129-3p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-129-P2_3p* (star (passenger))
  8. Columba livia (rock pigeon) Cli-Mir-129-P2_3p* (star (passenger))
  9. Danio rerio dre-miR-129-3-3p
  10. Dasypus novemcinctus dno-miR-129-3p
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-129-P2_3p* (star (passenger))
  12. Equus caballus eca-miR-129a-3p
  13. Gekko japonicus Gja-Mir-129-P2_3p* (star (passenger))
  14. Homo sapiens (human) hsa-miR-129-1-3p
  15. Latimeria chalumnae (coelacanth) Lch-Mir-129-P2_3p* (star (passenger))
  16. Lepisosteus oculatus (spotted gar) Loc-Mir-129-P2_3p* (star (passenger))
  17. Loxodonta africana (African savanna elephant) Laf-Mir-129-P2_3p* (star (passenger))
  18. Macaca mulatta mml-miR-129-1-3p
  19. Microcaecilia unicolor Mun-Mir-129-P2_3p* (star (passenger))
  20. Microcebus murinus (gray mouse lemur) Mmr-Mir-129-P2_3p* (star (passenger))
  21. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-129-P2_3p* (star (passenger))
  22. Monopterus albus (swamp eel) Mal-Mir-129-P2b_3p* (star (passenger))
  23. Mus musculus mmu-miR-129-1-3p
  24. Notamacropus eugenii (tammar wallaby) Neu-Mir-129-P2_3p* (star (passenger))
  25. Oryctolagus cuniculus ocu-miR-129-3p
  26. Pongo abelii (Sumatran orangutan) Pab-Mir-129-P2_3p (mature (co-guide))
  27. Pongo pygmaeus (Bornean orangutan) ppy-miR-129-1-3p
  28. Pteropus alecto (black flying fox) pal-miR-129b-3p
  29. Python bivittatus (Burmese python) Pbv-Mir-129-P2_3p* (star (passenger))
  30. Rattus norvegicus (Norway rat) Rno-Mir-129-P2_3p* (star (passenger))
  31. Salmo salar ssa-miR-129-3-3p
  32. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-129-P2_3p* (star (passenger))
  33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-129-P2_3p* (star (passenger))
  34. Sphenodon punctatus (tuatara) Spt-Mir-129-P2_3p* (star (passenger))
  35. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-129-P2b_3p* (star (passenger))
Relationships

Molecular Relationships