v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-10b precursor URS00004CAC40_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR10B: MIR10B is a miRNA that is upregulated in both KO and KI mice and negatively regulates spermatid differentiation [PMC10001410]. Mim23-expressing cells show upregulation of tumorigenic miR10a and MIR10B, as well as downregulation of antiproliferative miR129-5p, which is predicted to alter cell growth and invasion properties [PMC3892995].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Chlorocebus sabaeus (African green monkey) microRNA 10b (ENSCSAG00000020610.1)
  2. Pan paniscus microRNA ppa-mir-10b precursor
  3. Pan troglodytes ptr-mir-10b (ENSPTRG00000027738.2)
 Publications