Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Eumeta japonica tRNA secondary structure diagram

Eumeta japonica tRNA URS00004C8879_151549

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGAACCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 246 other species

  1. Acanthochromis polyacanthus tRNA
  2. Acanthoscelides obtectus tRNA
  3. Acyrthosiphon pisum (Pea aphid) tRNA-Gln
  4. Adelges cooleyi (Spruce gall adelgid) transfer RNA glutamine (anticodon UUG)
  5. Aethina tumida (Small hive beetle) transfer RNA glutamine (anticodon UUG)
  6. Agrilus planipennis (Emerald ash borer) tRNA-Gln
  7. Allacma fusca tRNA
  8. Alosa alosa (allis shad) tRNA-Gln
  9. Amphiprion ocellaris (clown anemonefish) tRNA
  10. Amyelois transitella (Moths) transfer RNA glutamine (anticodon UUG)
  11. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000003625.1
  12. Anniella stebbinsi tRNA-Gln
  13. Anolis carolinensis tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  14. Anoplophora glabripennis (Asian long-horned beetle) tRNA-Gln
  15. Anthonomus grandis grandis (Boll weevil) transfer RNA glutamine (anticodon UUG)
  16. Aphis craccivora (cowpea aphid) tRNA
  17. Aphis glycines (soybean aphid) tRNA
  18. Aphis gossypii (cotton aphid) tRNA
  19. Apis cerana cerana tRNA
  20. Apis dorsata (Giant honeybee) tRNA-Gln
  21. Apis florea (Dwarf honeybee) tRNA-Gln
  22. Apis mellifera tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  23. Apolygus lucorum tRNA
  24. Araneus ventricosus tRNA
  25. Argiope bruennichi (Wasp spider) transfer RNA glutamine (anticodon UUG)
  26. Aromia moschata tRNA-Gln
  27. Asbolus verrucosus (desert ironclad beetle) tRNA
  28. Atractosteus spatula (alligator gar) tRNA
  29. Betta splendens (Siamese fighting fish) tRNA
  30. Bicyclus anynana (squinting bush brown) misc RNA ENSINYG00000026284.1
  31. Biomphalaria glabrata tRNA
  32. Biomphalaria pfeifferi tRNA-Gln
  33. Bombus affinis (Rusty patched bumble bee) transfer RNA glutamine (anticodon UUG)
  34. Bombus huntii (Hunt's bumblebee) transfer RNA glutamine (anticodon UUG)
  35. Bombus impatiens (Common eastern bumblebee) tRNA-Gln
  36. Bombus terrestris misc RNA ENSBTSG00005020269.1
  37. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Gln
  38. Bombus vosnesenskii tRNA
  39. Bombyx mandarina tRNA-Gln
  40. Bombyx mori tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 5)
  41. Brassicogethes aeneus (rape pollen beetle) tRNA
  42. Brenthis ino (lesser marbled fritillary) tRNA
  43. Bugula neritina tRNA
  44. Caerostris darwini tRNA-Gln
  45. Caerostris extrusa tRNA-Gln
  46. Caligus rogercresseyi tRNA
  47. Callosobruchus analis hypothetical protein
  48. Callosobruchus chinensis hypothetical protein
  49. Callosobruchus maculatus (cowpea weevil) tRNA
  50. Candidula unifasciata tRNA
  51. Caranx melampygus tRNA-OTHER
  52. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  53. Chamberlinius hualienensis tRNA-Gln
  54. Chanos chanos (milkfish) tRNA
  55. Chrysodeixis includens tRNA
  56. Chrysoperla carnea (Green lacewing) tRNA-Gln
  57. Cinara cedri tRNA
  58. Clarias magur (asian catfish) tRNA
  59. Clupea harengus (Atlantic herring) tRNA
  60. Collichthys lucidus tRNA
  61. Cordylochernes scorpioides tRNA-Gln
  62. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  63. Magallana angulata Crassostrea angulata (Portuguese oyster) transfer RNA glutamine (anticodon UUG)
  64. Crassostrea virginica (Eastern oyster) tRNA-Gln
  65. Cryptolaemus montrouzieri tRNA-Gln
  66. Ctenocephalides felis (Cat flea) tRNA-Gln
  67. Cydia pomonella (The codling moth) transfer RNA glutamine (anticodon UUG)
  68. Cylas formicarius (Sweet potato weevil) transfer RNA glutamine (anticodon UUG)
  69. Cynoglossus semilaevis (tongue sole) tRNA
  70. Cyprinus carpio carpio tRNA
  71. Cyprinus carpio (common carp) tRNA
  72. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA glutamine (anticodon UUG)
  73. Danaus chrysippus (African queen) tRNA
  74. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018347.1
  75. Danaus plexippus plexippus (Monarch butterfly) tRNA-Gln
  76. Dendroctonus ponderosae (Mountain pine beetle) tRNA-Gln
  77. Diabrotica balteata tRNA
  78. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA glutamine (anticodon UUG)
  79. Diatraea saccharalis (sugarcane borer) tRNA
  80. Dicentrarchus labrax (European seabass) tRNA
  81. Dinoponera quadriceps (south american ant) tRNA
  82. Dinothrombium tinctorium tRNA
  83. Dissostichus eleginoides tRNA-Gln
  84. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  85. Dryococelus australis tRNA-OTHER
  86. Dufourea novaeangliae tRNA-Gln
  87. Echeneis naucrates (live sharksucker) tRNA
  88. Eleutherodactylus coqui (Puerto Rican coqui) tRNA
  89. Elysia chlorotica (eastern emerald elysia) tRNA
  90. Erpetoichthys calabaricus (reedfish) tRNA
  91. Eufriesea mexicana tRNA-Gln
  92. Exocentrus adspersus tRNA-Gln
  93. Frieseomelitta varia tRNA
  94. Galendromus occidentalis (Western predatory mite) tRNA-Gln
  95. Galleria mellonella (greater wax moth) tRNA
  96. Gekko kuhli tRNA-Gln
  97. Geotrypetes seraphini tRNA
  98. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014487.1
  99. Gouania willdenowi (blunt-snouted clingfish) tRNA
  100. Haplochromis burtoni tRNA
  101. Harpegnathos saltator (Indian jumping ant) tRNA-Gln
  102. Heliconius melpomene (Postman butterfly) tRNA HMEL004786
  103. Helicoverpa armigera transfer RNA glutamine (anticodon UUG)
  104. Helicoverpa zea tRNA-Gln
  105. Heliothis virescens (tobacco budworm) tRNA
  106. Hemibagrus wyckioides tRNA
  107. Henosepilachna vigintioctopunctata tRNA-Gln
  108. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Gln
  109. Homo sapiens tRNA-Gln (UUG)
  110. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA glutamine (anticodon UUG)
  111. Hymenochirus boettgeri tRNA
  112. Hypothenemus hampei tRNA-Gln
  113. Ignelater luminosus (cucubano) tRNA
  114. Larimichthys crocea tRNA
  115. Lates calcarifer (barramundi perch) tRNA
  116. Laticauda laticaudata (blue-ringed sea krait) tRNA
  117. Leguminivora glycinivorella tRNA-Gln
  118. Lepisosteus oculatus tRNA
  119. Leptidea sinapis tRNA
  120. Leptinotarsa decemlineata tRNA-Gln
  121. Leptobrachium leishanense (Leishan spiny toad) tRNA
  122. Leptotrombidium deliense tRNA-Gln for anticodon UUG
  123. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015014953.1
  124. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005015824.1
  125. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015829.1
  126. Limnoperna fortunei (Golden mussel) misc RNA ENSLFOG00000068249.1
  127. Limulus polyphemus tRNA-Gln
  128. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015025989.1
  129. Lingula anatina (Lamp shell) tRNA-Gln
  130. Liolophura japonica (Chitons) transfer RNA glutamine (anticodon UUG)
  131. Lutzomyia longipalpis tRNA tRNA-Gln
  132. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011447.1
  133. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA glutamine (anticodon UUG)
  134. Magallana gigas (Pacific oyster) transfer RNA glutamine (anticodon UUG)
  135. Manduca sexta tRNA-Gln
  136. Maylandia zebra (zebra mbuna) tRNA
  137. Megachile rotundata tRNA-Gln
  138. Melanaphis sacchari (Sugarcane aphid) tRNA-Gln
  139. Melipona bicolor tRNA
  140. Melipona quadrifasciata tRNA
  141. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023569.1
  142. Microcaecilia unicolor tRNA
  143. Molorchus minor tRNA-Gln
  144. Monomorium pharaonis (Pharaoh ant) tRNA-Gln
  145. Myripristis murdjan (pinecone soldierfish) tRNA
  146. Mytilus californianus (California mussel) transfer RNA glutamine (anticodon UUG)
  147. Mytilus coruscus tRNA
  148. Mytilus edulis tRNA
  149. Mytilus galloprovincialis tRNA
  150. Naja naja tRNA
  151. Neogobius melanostomus (round goby) tRNA
  152. Neolamprologus brichardi tRNA
  153. Nephila pilipes tRNA
  154. Nezara viridula (southern green stink bug) tRNA
  155. Notechis scutatus tRNA
  156. Onthophagus taurus tRNA-Gln
  157. Operophtera brumata tRNA
  158. Ophiophagus hannah tRNA
  159. Ornithodoros turicata (Softbacked ticks) transfer RNA glutamine (anticodon UUG)
  160. Ornithorhynchus anatinus tRNA-Gln (TTG) (tRNA-Gln-TTG-2-1, tRNA-Gln-TTG-2-2)
  161. Oryctes borbonicus tRNA
  162. Oryzias latipes tRNA-Gln (TTG) (tRNA-Gln-TTG-1-1)
  163. Oryzias sinensis tRNA
  164. Ostrea edulis (Mud oyster) transfer RNA glutamine (anticodon UUG)
  165. Pangasianodon gigas (Mekong giant catfish) tRNA-Gln
  166. Pangasianodon hypophthalmus tRNA
  167. Pantherophis guttatus tRNA
  168. Papilio machaon tRNA
  169. Papilio xuthus tRNA
  170. Pararge aegeria aegeria tRNA
  171. Pararge aegeria tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 5)
  172. Arctia plantaginis Parasemia plantaginis tRNA
  173. Parasteatoda tepidariorum (Common house spider) tRNA-Gln
  174. Parnassius apollo (apollo) tRNA
  175. Pectinophora gossypiella transfer RNA glutamine (anticodon UUG)
  176. Pediculus humanus corporis (Human body louse) tRNA tRNA-Gln
  177. Pelobates cultripes (western spadefoot toad) tRNA.Gln
  178. Phaedon cochleariae (mustard beetle) tRNA
  179. Phlebotomus argentipes (Sand fly) transfer RNA glutamine (anticodon UUG)
  180. Phlebotomus papatasi tRNA tRNA-Gln
  181. Photinus pyralis (Common eastern firefly) tRNA-Gln
  182. Phrynocephalus forsythii tRNA
  183. Phthorimaea operculella tRNA-Gln
  184. Phyllotreta striolata tRNA
  185. Pieris brassicae (large cabbage white) tRNA
  186. Pieris macdunnoughi tRNA
  187. Plodia interpunctella (Indianmeal moth) transfer RNA glutamine (anticodon UUG)
  188. Plutella xylostella (diamondback moth) tRNA
  189. Podarcis lilfordi tRNA
  190. Podarcis muralis tRNA
  191. Pogona vitticeps (central bearded dragon) tRNA
  192. Pogonomyrmex barbatus (Red harvester ant) tRNA-Gln
  193. Pogonomyrmex californicus tRNA-Gln
  194. Polistes dominula tRNA-Gln
  195. Polistes fuscatus tRNA-Gln
  196. Polyplax serrata tRNA-Gln
  197. Polypterus senegalus tRNA
  198. Pomacea canaliculata tRNA-Gln
  199. Potamilus streckersoni tRNA-Gln
  200. Priapulus caudatus tRNA-Gln
  201. Pseudonaja textilis tRNA
  202. Psylliodes chrysocephalus Psylliodes chrysocephala tRNA
  203. Pundamilia nyererei tRNA
  204. Pycnogonum litorale transfer RNA
  205. Python bivittatus Python molurus bivittatus (Burmese python) tRNA
  206. Aquarana catesbeiana Rana catesbeiana (bullfrog) tRNA
  207. Rhamnusium bicolor tRNA-Gln
  208. Rhopalosiphum maidis tRNA-Gln
  209. Rhynchophorus ferrugineus (red palm weevil) tRNA
  210. Salarias fasciatus (jewelled blenny) tRNA
  211. Sander lucioperca (pike-perch) tRNA
  212. Sergentomyia squamirostris tRNA-Gln
  213. Silurus meridionalis tRNA
  214. Sipha flava (Yellow sugarcane aphid) tRNA-Gln
  215. Sitophilus oryzae tRNA-Gln
  216. Sphaeramia orbicularis tRNA
  217. Sphaerodactylus townsendi tRNA-Gln
  218. Spodoptera exigua (beet armyworm) tRNA
  219. Spodoptera frugiperda tRNA-Gln (TTG) (tRNA-Gln-TTG-2 1 to 5)
  220. Spodoptera littoralis tRNA
  221. Spodoptera litura tRNA
  222. Stegastes partitus (bicolor damselfish) tRNA
  223. Stegodyphus dumicola (Social spider) tRNA-Gln
  224. Stegodyphus mimosarum tRNA-Gln for anticodon UUG
  225. Temnothorax curvispinosus tRNA
  226. Tenebrio molitor (yellow mealworm) tRNA
  227. Tribolium castaneum transfer RNA glutamine (anticodon UUG)
  228. Tribolium madens (Black flour beetle) tRNA-Gln
  229. Trichogramma brassicae tRNA
  230. Trichogramma pretiosum tRNA-Gln
  231. Trichonephila clavata (joro spider) tRNA
  232. Trichonephila clavipes (golden silk orbweaver) tRNA
  233. Trichonephila inaurata madagascariensis tRNA
  234. Trichoplusia ni (cabbage looper) tRNA
  235. Tropilaelaps mercedesae tRNA
  236. Uloborus diversus (Orb Weaver) transfer RNA glutamine (anticodon UUG)
  237. Vanessa tameamea tRNA
  238. Varanus komodoensis tRNA
  239. Varroa destructor (Honeybee mite) tRNA-Gln
  240. Varroa jacobsoni (Varroa mite) tRNA-Gln
  241. Vespa mandarinia (Asian giant hornet) tRNA-Gln
  242. Vespula germanica tRNA
  243. Vespula pensylvanica (western yellowjacket) tRNA
  244. Vespula vulgaris tRNA
  245. Xenopus laevis (African clawed frog) tRNA
  246. Xenopus petersii tRNA-Gln
  247. Xenopus tropicalis tRNA-Gln (TTG) (tRNA-Gln-TTG-1 1 to 17)
  248. Zerene cesonia (Southern Dogface) tRNA-Gln
  249. Zophobas morio tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications