Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1355 tRNA-Leu secondary structure diagram

Saccharomyces cerevisiae YJM1355 tRNA-Leu URS00004C1880_1294353

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUAUUUUGGUGGAAUUGGUAGACACGAUACUCUUAAGAUGUAUUACUUUACAGUAUGAAGGUUCAAGUCCUUUAAAUAGCAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 100 other species

  1. Saccharomyces cerevisiae (baker's yeast) tRNA-Leu
  2. Saccharomyces cerevisiae Kyokai no. 7 Mitochondrial tRNA-Leu
  3. Saccharomyces cerevisiae PE-2 tRNA-Leu
  4. Saccharomyces cerevisiae S288C tRNA-Leu
  5. Saccharomyces cerevisiae x Saccharomyces paradoxus tRNA-Leu
  6. Saccharomyces cerevisiae YJM1078 tRNA-Leu
  7. Saccharomyces cerevisiae YJM1083 tRNA-Leu
  8. Saccharomyces cerevisiae YJM1129 tRNA-Leu
  9. Saccharomyces cerevisiae YJM1133 tRNA-Leu
  10. Saccharomyces cerevisiae YJM1190 tRNA-Leu
  11. Saccharomyces cerevisiae YJM1199 tRNA-Leu
  12. Saccharomyces cerevisiae YJM1202 tRNA-Leu
  13. Saccharomyces cerevisiae YJM1208 tRNA-Leu
  14. Saccharomyces cerevisiae YJM1242 tRNA-Leu
  15. Saccharomyces cerevisiae YJM1244 tRNA-Leu
  16. Saccharomyces cerevisiae YJM1248 tRNA-Leu
  17. Saccharomyces cerevisiae YJM1250 tRNA-Leu
  18. Saccharomyces cerevisiae YJM1252 tRNA-Leu
  19. Saccharomyces cerevisiae YJM1273 tRNA-Leu
  20. Saccharomyces cerevisiae YJM1304 tRNA-Leu
  21. Saccharomyces cerevisiae YJM1307 tRNA-Leu
  22. Saccharomyces cerevisiae YJM1311 tRNA-Leu
  23. Saccharomyces cerevisiae YJM1326 tRNA-Leu
  24. Saccharomyces cerevisiae YJM1332 tRNA-Leu
  25. Saccharomyces cerevisiae YJM1336 tRNA-Leu
  26. Saccharomyces cerevisiae YJM1338 tRNA-Leu
  27. Saccharomyces cerevisiae YJM1341 tRNA-Leu
  28. Saccharomyces cerevisiae YJM1342 tRNA-Leu
  29. Saccharomyces cerevisiae YJM1356 tRNA-Leu
  30. Saccharomyces cerevisiae YJM1381 tRNA-Leu
  31. Saccharomyces cerevisiae YJM1383 tRNA-Leu
  32. Saccharomyces cerevisiae YJM1385 tRNA-Leu
  33. Saccharomyces cerevisiae YJM1386 tRNA-Leu
  34. Saccharomyces cerevisiae YJM1387 tRNA-Leu
  35. Saccharomyces cerevisiae YJM1388 tRNA-Leu
  36. Saccharomyces cerevisiae YJM1389 tRNA-Leu
  37. Saccharomyces cerevisiae YJM1399 tRNA-Leu
  38. Saccharomyces cerevisiae YJM1400 tRNA-Leu
  39. Saccharomyces cerevisiae YJM1401 tRNA-Leu
  40. Saccharomyces cerevisiae YJM1402 tRNA-Leu
  41. Saccharomyces cerevisiae YJM1415 tRNA-Leu
  42. Saccharomyces cerevisiae YJM1417 tRNA-Leu
  43. Saccharomyces cerevisiae YJM1418 tRNA-Leu
  44. Saccharomyces cerevisiae YJM1419 tRNA-Leu
  45. Saccharomyces cerevisiae YJM1433 tRNA-Leu
  46. Saccharomyces cerevisiae YJM1434 tRNA-Leu
  47. Saccharomyces cerevisiae YJM1439 tRNA-Leu
  48. Saccharomyces cerevisiae YJM1443 tRNA-Leu
  49. Saccharomyces cerevisiae YJM1444 tRNA-Leu
  50. Saccharomyces cerevisiae YJM1447 tRNA-Leu
  51. Saccharomyces cerevisiae YJM1450 tRNA-Leu
  52. Saccharomyces cerevisiae YJM1460 tRNA-Leu
  53. Saccharomyces cerevisiae YJM1463 tRNA-Leu
  54. Saccharomyces cerevisiae YJM1477 tRNA-Leu
  55. Saccharomyces cerevisiae YJM1478 tRNA-Leu
  56. Saccharomyces cerevisiae YJM1479 tRNA-Leu
  57. Saccharomyces cerevisiae YJM1526 tRNA-Leu
  58. Saccharomyces cerevisiae YJM1527 tRNA-Leu
  59. Saccharomyces cerevisiae YJM1549 tRNA-Leu
  60. Saccharomyces cerevisiae YJM1573 tRNA-Leu
  61. Saccharomyces cerevisiae YJM1574 tRNA-Leu
  62. Saccharomyces cerevisiae YJM1592 tRNA-Leu
  63. Saccharomyces cerevisiae YJM1615 tRNA-Leu
  64. Saccharomyces cerevisiae YJM189 tRNA-Leu
  65. Saccharomyces cerevisiae YJM193 tRNA-Leu
  66. Saccharomyces cerevisiae YJM195 tRNA-Leu
  67. Saccharomyces cerevisiae YJM244 tRNA-Leu
  68. Saccharomyces cerevisiae YJM248 tRNA-Leu
  69. Saccharomyces cerevisiae YJM270 tRNA-Leu
  70. Saccharomyces cerevisiae YJM271 tRNA-Leu
  71. Saccharomyces cerevisiae YJM320 tRNA-Leu
  72. Saccharomyces cerevisiae YJM326 tRNA-Leu
  73. Saccharomyces cerevisiae YJM428 tRNA-Leu
  74. Saccharomyces cerevisiae YJM450 tRNA-Leu
  75. Saccharomyces cerevisiae YJM451 tRNA-Leu
  76. Saccharomyces cerevisiae YJM453 tRNA-Leu
  77. Saccharomyces cerevisiae YJM456 tRNA-Leu
  78. Saccharomyces cerevisiae YJM470 tRNA-Leu
  79. Saccharomyces cerevisiae YJM541 tRNA-Leu
  80. Saccharomyces cerevisiae YJM554 tRNA-Leu
  81. Saccharomyces cerevisiae YJM555 tRNA-Leu
  82. Saccharomyces cerevisiae YJM627 tRNA-Leu
  83. Saccharomyces cerevisiae YJM681 tRNA-Leu
  84. Saccharomyces cerevisiae YJM682 tRNA-Leu
  85. Saccharomyces cerevisiae YJM683 tRNA-Leu
  86. Saccharomyces cerevisiae YJM689 tRNA-Leu
  87. Saccharomyces cerevisiae YJM693 tRNA-Leu
  88. Saccharomyces cerevisiae YJM789 tRNA-Leu
  89. Saccharomyces cerevisiae YJM969 tRNA-Leu
  90. Saccharomyces cerevisiae YJM972 tRNA-Leu
  91. Saccharomyces cerevisiae YJM975 tRNA-Leu
  92. Saccharomyces cerevisiae YJM978 tRNA-Leu
  93. Saccharomyces cerevisiae YJM981 tRNA-Leu
  94. Saccharomyces cerevisiae YJM984 tRNA-Leu
  95. Saccharomyces cerevisiae YJM987 tRNA-Leu
  96. Saccharomyces cerevisiae YJM990 tRNA-Leu
  97. Saccharomyces cerevisiae YJM993 tRNA-Leu
  98. Saccharomyces cerevisiae YJM996 tRNA-Leu
  99. Saccharomyces kudriavzevii tRNA-Leu
  100. Saccharomyces paradoxus tRNA-Leu
2D structure