Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-3000 URS00004BF52E_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-3000: bmo-mir-3000 is a microRNA that has been observed to be upregulated during infection with L. monocytogenes and downregulated upon infection with L. innocua [PMC5733040]. In a study, it was found that bmo-mir-3000 targets chitotriosidase-1 and cytochrome P450 6B4 (CYP6B4), while cytochrome P450 4G1 (CYP4G1) is a putative target of dme-miR-954-5p [PMC5733040]. The expression levels of bmo-mir-3000 and dme-miR-954-3p were found to be increased, which was associated with decreased mRNA levels of chitotriosidase-1, CYP6B4, and CYP4G1 [PMC5733040]. The microarray results were in excellent agreement with the expression levels of miRNAs dme-miR-133-3p, dme-miR-998-3p, dme-miR9545p, and bmo-mir3000 [PMC5733040]. In silico miRNA target prediction revealed 1,822 potential targets for the four miRNAs (dme-miR9545p, bmo-mir3000, dme-miR9983p, and dme-miR1333p) [PMC5733040]. The expression levels of these four miRNAs were validated using quantitative real-time PCR [PMC5733040]. Chitotriosidase1 was found to be targeted by inversely transcribed dmemiR9983p and bmo mir3000 [PMC5733040]. Interestingly, in response to L. innocua infection, no significant change in the expression levels of these miRNAs was observed, except for bmo-mir-3000, which exhibited an inverse expression profile [PMC5733040].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCGCUUAGAUGAAGACACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications