Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-717 URS00004BC80D_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-717: Mmu-mir-717 is a miRNA gene that has been studied in relation to its association with various phenotypes in mice. It is a seed SNP in mmu-mir-717 (rs30372501) that has been found to be associated with leanness [PMC3267754]. The association between the mmu-mir-717 SNP (rs30372501) and phenotypes was analyzed using a linear model [PMC3267754]. The analysis showed that the mmu-mir-717 SNP (rs30372501) was associated with a diverse array of traits [PMC3267754]. Additionally, there is an overlap between mmu-mir-717, a miR-seed-SNP identified in the lean mouse strain 129/Sv, a body mass associated gene Gpc3, and a growth associated QTL [PMC3675212]. A molecular marker within the mmu-mir-717 gene has also been identified in relation to growth rate and associated genes [PMC4091431]. Furthermore, eight miRNAs including mmu-mir-717 were found to be upregulated in mice with diet-induced obesity [PMC4571067]. These studies highlight the potential role of mmu-mir-717 and its seed SNP rs30372501 in influencing various phenotypes and provide insights into its molecular mechanisms.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCAGACAGAGAUACCUUCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications