Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla ggo-miR-628 (MIR628) URS00004B83FE_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGCUGACAUAUUUACUAGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus bta-miR-628
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-628
  3. Canis lupus familiaris (dog) cfa-miR-628
  4. Cricetulus griseus (Chinese hamster) cgr-miR-628
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-628-5p
  6. Echinops telfairi Ete-Mir-628_5p (mature (guide))
  7. Equus caballus eca-miR-628a
  8. Gorilla gorilla (western gorilla) ggo-miR-628
  9. Homo sapiens (human) hsa-miR-628-5p
  10. Macaca mulatta (Rhesus monkey) mml-miR-628-5p
  11. Nomascus leucogenys nle-miR-628
  12. Pongo pygmaeus ppy-miR-628-5p
  13. Pteropus alecto (black flying fox) pal-miR-628-5p
  14. Sus scrofa ssc-miR-628-5p
  15. Tupaia chinensis (Chinese tree shrew) tch-miR-628-5p
Publications